autoannotate addon error in UMD version

Question

autoannotate addon error in UMD version

magelan opened this issue 2 years ago · 6 comments

Hi,

trying to get the autoannotate addon working in universal mode.
The linked html example file in the readme does not exist anymore.
https://github.com/TeselaGen/openVectorEditor#full-example
so I build instead on the deployed example and use this code:

<html>
  <head>
    <link
      rel="stylesheet"
      type="text/css"
      href="https://unpkg.com/open-vector-editor/umd/main.css"
    />
  </head>
  <body style="display: flex">

    <script
      type="text/javascript"
      src="https://unpkg.com/open-vector-editor/umd/open-vector-editor.js"
    ></script>
     <script
      type="text/javascript"
      src="https://unpkg.com/ove-auto-annotate/umd/ove-auto-annotate.js"

    ></script>
    <script type="text/javascript">


      const editor3 = window.createVectorEditor("createDomNodeForMe", {
        autoAnnotateFeatures: window._ove_addons.autoAnnotateFeatures,
          withPreviewMode: false,
        showMenuBar: true,
        editorName: "YetAnotherSequence"
      });
      /* createDomNodeForMe will make a dom node for you and append it to the document.body*/
      editor3.updateEditor({
          readOnly:false,
        autoAnnotateFeatures: window._ove_addons.autoAnnotateFeatures,
        sequenceData: {
          name: "Wait for Me!",
          circular: true,
          sequence:
            "gtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaaccccccgtaacccccc",
          features: [
            {
              id: "19f0fjj",
              name: "abcd",
              type: "RBS",
              start: 1,
              end: 5
            },

            {
              id: "24t2t",
              name: "pj1",
              type: "CDS",
              start: 10,
              end: 50
            },
            {
              id: "82020000",
              name: "pj3",
              type: "CDS",
              start: 10,
              end: 50
            }
          ]
        }
      });
    </script>
  </body>
</html>

Using the autoannotate function gives me the error popup:
Error annotating feature(s). Double check your file to make sure it is valid!
Even if I use the downloaded examples for both csv and ApE files.
The console error message is:

"index.js:426 error: TypeError: Cannot read properties of undefined (reading 'find')
at _callee2$ (index.js:288:50)
at tryCatch (runtime.js:63:15)
at Generator.invoke [as _invoke] (runtime.js:293:1)
at Generator.next (runtime.js:118:1)
at src_asyncGeneratorStep (ove-auto-annotate.js:1415:107)
at _next (ove-auto-annotate.js:1417:197)
at ove-auto-annotate.js:1417:375
at new Promise ()
at ove-auto-annotate.js:1417:100
at validateRow (index.js:279:31)
at _callee3$ (index.js:364:23)
at tryCatch (runtime.js:63:15)
at Generator.invoke [as _invoke] (runtime.js:293:1)
at Generator.next (runtime.js:118:1)
at src_asyncGeneratorStep (ove-auto-annotate.js:1415:107)
at _next (ove-auto-annotate.js:1417:197)"

Is autoannotate not supported in the UMD version?

Cheers
Franz

Answer 1 · 2023-02-13T17:32:44.000Z

Hi Franz,

Thanks for the issue, I'll look into this today and get back to you..

Answer 2 · 2023-02-13T19:16:51.000Z

Hi Franz @magelan ,

I think I've found the issue and am releasing a new version of the auto annotate plugin. This should hopefully fix the error you were seeing.

Answer 3 · 2023-02-14T08:07:27.000Z

Hi @tnrich,

cool, thanks 👍

Answer 4 · 2023-02-14T20:20:03.000Z

@magelan lemme know if that solves your issue. This was caused by me forgetting to re-publish the auto-annotate package after making a change to it! It might have other issues still possibly..

Answer 5 · 2023-02-15T11:18:21.000Z

@tnrich
Well, it solved the issue with the file format message, but just get a white page now, with this error at the console:

Answer 6 · 2023-02-15T16:59:12.000Z

Hmm interesting I wonder what's causing that. I'll need to look into that..