`--seq-matches` should distinguish deltas somehow

[jeffkaufman]

$ seqdsp tests/a.fasta --seq-matches TGGGAGTTT
TCAGTTTCAGATT[TGGGTGTTT]TATGATTTATACTATACGTGACAAGAAAGTTGTC

Note that it has matched TGGGTGTTT with TGGGAGTTT (a single substitution), but you can't tell the match quality visually.

For substitutions we could either underline or not color the matching section

Insertions are already displayed fine, by not coloring.

Deletions are hard to display, since there's nothing to be shown. Maybe put a - in the sequence?

[jeffkaufman]

done in d143bc9