/ncRNABert

ncRNABert: Deciphering the landscape of non-coding RNA using language model

Primary LanguagePythonApache License 2.0Apache-2.0

ncRNABert: Deciphering the landscape of non-coding RNA using language model

PyPI - Version PyPI - Python Version GitHub - LICENSE PyPI - Downloads Wheel build

Model details

Model # of parameters # of hidden size Pretraining dataset # of ncRNAs Model download
ncRNABert 303M 1024 RNAcentral 26M Download
ncRNABert 303M 1024 RNAcentral + nt - Download

Install

As a prerequisite, you must have PyTorch installed to use this repository.

You can use this one-liner for installation, using the latest release version

# latest version
pip install git+https://github.com/wangleiofficial/ncRNABert

# stable version
pip install ncRNABert

Usage

ncRNA sequence embedding

from ncRNABert.pretrain import load_ncRNABert, load_ncRNABert_ex
from ncRNABert.utils import BatchConverter
import torch

data = [
    ("ncRNA1", "ACGGAGGATGCGAGCGTTATCCGGATTTACTGGGCG"),
    ("ncRNA2", "AGGTTTTTAATCTAATTAAGATAGTTGA"),
]

ids, batch_token, lengths = BatchConverter(data)
model = load_ncRNABert()
model_ex = load_ncRNABert_ex()
with torch.no_grad():
    results = model(batch_token, lengths, repr_layers=[24])
    results_ex = model_ex(batch_token, lengths, repr_layers=[24])
# Generate per-sequence representations via averaging
token_representations = results["representations"][24]
token_representations_ex = results_ex["representations"][24]
sequence_representations = []
sequence_representations_ex = []
batch_lens = [len(item[1]) for item in data]
for i, tokens_len in enumerate(batch_lens):
    sequence_representations.append(token_representations[i, 1 : tokens_len - 1].mean(0))
    sequence_representations_ex.append(token_representations_ex[i, 1 : tokens_len - 1].mean(0))

License

This source code is licensed under the Apache-2.0 license found in the LICENSE file in the root directory of this source tree.