I will generate GVCFs of following samples:
- 10 new Lynx pardinus - sierra morena : 211, 220, 225, 239, 278, 377, 390, 452, 474, 614
- 5 Lynx lynx - east : 112, 114, 137, 141, 146
- 5 Lynx lynx - west : 45, 90, 202, 211, 212
- 3 Lynx lynx - lesser caucasus : 240, 242, 247
- 5 Lynx lynx - dagestan : 241 (high ROH!), 243, 244, 259, 260
- All (20) Lynx canadensis : 3 and 12 are differentiated in PC1 and PC2 respectively and 7 is shit
- All (18) Lynx rufus (11 is a canada lynx)
Full information can be found in the excel table of all the samples.
Missing information:
- lp permit numbers
- lp tissues
- lc3, lc9999 location, tissue, permits
- lc permits
- lr5, lr6, lr7, lr8, lr9, lr10, lr18, lr19, lr21 tissues
- lr5, lr6, lr12, lr21 permits
- lr5, lr6, lr21 location
I run fastqc to check the quality of rawreads from sequencing. Scripts to be submitted to slurm queue in cesga ft3 were generated using the information contained in the all_rawreads_fastqs configuration file with the make_fastqc_scripts python script:
python scripts/make_fastqc_scripts.py config/all_rawreads_fastqs.yml
The generated scripts were then submitted to the job queue on cesga ft3:
# sbatch ll samples:
for sh in $(ls scripts/rawreads_fastqc/*.sh | grep "_ll_")
do
echo "sbatch $sh"
sbatch $sh
done
# sbatch lc and lr samples:
for sh in $(ls scripts/rawreads_fastqc/*.sh | grep -E "_lc_|_lr_")
do
echo "sbatch $sh"
sbatch $sh
done
Then I can run multiqc, Ewels et al. (2016) to check outputs:
module load cesga/2020 multiqc/1.14-python-3.9.9
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LYNX_24/20200405/FASTQ/fastqc
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LYNX_20/FASTQ/fastqc
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LYNX_21/FASTQ/fastqc
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LRU_30/fastqc
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/MAGROGEN/fastqc
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/Canada_data_CandadaLynxes/share/fastqc
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/Bobcat1/fastqc
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/USA_data_Bobcats/fastqc
multiqc /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LCA_3/fastqc
Analyzing fastqc and multiqc reports we see that
LYNX_20, LYNX_21, LYNX_24 have very-low to fail levels of:
- Illumina universal adapter content
- Poly-G sequences
Bobcat1 have warning levels of:
- Nextera transposase adapters
Canada_data_CandadaLynxes have very-low to warning levels of:
- Illumina universal adapter content
- Poly-G sequences and one failed GC-content
MAGROGEN LL212 has warnings for:
- Overrepresented TruSeq Adapter (ATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTATG)
- Overrepresented Illumina Single End PCR Primer 1 (ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCTC)
USA_data_Bobcats have very-low to warning levels of:
- Nextera transposase adapters
- Poly-G sequences
Seeing the warnings I receive from fastqc reports I need to process the rawreads to try to remove them.
I use fastp from Chen et al. (2018) with default settings plus the following flags:
--dont_overwrite (protect the existing files not to be overwritten by fastp)
--trim_poly_g (detect the polyG in read tails and trim them)
--length_required 30 (reads shorter than length_required will be discarded)
--correction (enable base correction in overlapped regions)
--detect_adapter_for_pe (enable adapter sequence auto-detection)
--thread 6 (worker thread number)
Scripts that run fastp on each fastq pair separately were generated using the information contained in the all_rawreads_fastqs configuration file with the make_fastp_scripts python script:
python scripts/make_fastp_scripts.py config/all_rawreads_fastqs.yml
The generated scripts were then submitted to the job queue on cesga ft3:
# sbatch ll samples:
for sh in $(ls scripts/fastp/*.sh | grep "_ll_")
do
echo "sbatch $sh"
sbatch $sh
done
# sbatch lc and lr samples:
for sh in $(ls scripts/fastp/*.sh | grep -E "_lc_|_lr_")
do
echo "sbatch $sh"
sbatch $sh
done
To check on how the fastp run went I run fastqc on the newly generated fastq pairs from fastp. This time I use a different configuration file with the fastp folders and fastq files using the make_fastqc_scripts python script again:
python scripts/make_fastqc_scripts.py config/all_fastp_fastqs.yml
The generated scripts were then submitted to the job queue on cesga ft3:
# sbatch ll samples:
for sh in $(ls scripts/fastqc/*.sh | grep "_ll_")
do
echo "sbatch $sh"
sbatch $sh
done
# sbatch lc and lr samples:
for sh in $(ls scripts/fastqc/*.sh | grep -E "_lc_|_lr_")
do
echo "sbatch $sh"
sbatch $sh
done
Then I can run multiqc to check outputs:
module load cesga/2020 multiqc/1.14-python-3.9.9
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LYNX_24/20200405/FASTQ/fastp/fastqc
multiqc .
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LYNX_20/FASTQ/fastp/fastqc
multiqc .
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LYNX_21/FASTQ/fastp/fastqc
multiqc .
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LRU_30/fastp/fastqc
multiqc .
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/MAGROGEN/fastp/fastqc
multiqc .
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/Canada_data_CandadaLynxes/share/fastp/fastqc
multiqc .
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/Bobcat1/fastp/fastqc
multiqc .
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/USA_data_Bobcats/fastp/fastqc
multiqc .
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/lynx_genome/lynx_data/FASTQ_files/LCA_3/fastp/fastqc
multiqc .
It seems that the only samples that after fastp could still be problematic are:
- c_lc_yu_0007, c_lr_vt_0014, c_lr_vt_0020 -> very odd Per Seqeunce GC Content
I align the my samples to the Lynx rufus reference genome.
A script will be run for each sample that will use bwa v0.7.17, samtools v1.9, picard v2.25.5 and gatk v3.7-0 that will do the following:
- Align each of the sample's R1-R2 fastq pairs to the reference genome using BWA-MEM and Samtools view
- samtools sort to sort the reads in the bam file
- picardtools AddOrReplaceReadGroups to add read groups to the reads in the bam file
- samtools merge to merge the bam files from the multiple R1-R2 pairs of the sample if necessary
- picardtools MarkDuplicates to mark duplicate reads in the bam
- realign indels with GATK which comprises:
- gatk RealignerTargetCreator to identify realign targets
- gatk IndelRealigner to realign the indels
- samtools index to index the indel realigned bam for downstream analyses
Scripts that will run the alignment pipeline for each sample in the alignment configuration file are generated using the run_alignment python script with the flag --test
:
cd scripts/alignment
for sample in $(python ../../scripts/print_samples_in_config.py ../../config/all_fastp_alignment.yml)
do
echo "generating alignment script of $sample"
python ../../src/congenomics_fastq_align-main/run_alignment.py --sample $sample --config ../../config/all_fastp_alignment.yml --test
done
To prepare the reference genome for the alignment I run:
module load cesga/2020 gcccore/system
module load bwa/0.7.17
module load samtools/1.9
module load gatk/3.7-0-gcfedb67
cd /mnt/lustre/hsm/nlsas/notape/home/csic/ebd/jgl/reference_genomes/lynx_rufus_mLynRuf2.2/
samtools faidx mLynRuf2.2.revcomp.scaffolds.fa
bwa index mLynRuf2.2.revcomp.scaffolds.fa
java -jar ${EBROOTGATK}/GenomeAnalysisTK.jar -T CreateSequenceDictionary -R mLynRuf2.2.revcomp.scaffolds.fa
The generated scripts were then submitted to the job queue on cesga ft3:
# sbatch all except lr
for sh in $(ls scripts/alignment/*.sh | grep -v "lr")
do
echo "sbatching $sh"
sbatch $sh
done
Run variant calling
Filter variants
Identify windows
Run lynx_ea_abc - invasive weed
Run simulations of best models
Run ABC