PAM Prediction HomoLogous Enhancement Toolkit (DEV version)
Python packages: argparse, Biopython, pyfaidx, urllib, requests, func_timeout
Softwares: WebLOGO(need GhostScript), seqkit (ADD TO PATH)
NEED INTERNET CONNECTION
-s,--spacer: Input spacer sequences, required.
-r,--repeat: Input repeat sequences, need to be used together with -p or -P and -r, not required.
-p,--protein: Relative Cas protein sequences, need to be used together with -r, not required.
-o,--outdir: Output directory, required. Need to specify a path that does not exist。
-O,--orientation: CRISPR array orientation, choices = positive or negative. Default is positive
-u,--unique: Unique mode, if set, only revise unique spacer.
-P,--proteinblast: Protein blastp output file in outfmt 6. Do not co-submit with -p
-l,--proteinlen: Protein length, need to be used together with -P
-d,--spacerdb: Spacer blast database, choices = phage or prokaryote. Default is phage
-L,--flanklen: Length of flank sequence, default is 12
-R,--refmode: Reference mode, choices = r or nr or a. r means reference mode, which use taxid to revise homologue protein. nr is non-reference mode (use most-redundant taxid as homologue protein reference) and a is all-mode (use all significant hit as homologue protein). Default is r
-f,--freqmode: Base frequency calculation mode, choices = linear and sigmoid, which effect weblogo. Default is sigmoid
-b,--blastmode: Spacer blastn mode. Common mode means use default blastn parameters and strict mode means use specific parameters, which could get more putative protospacers but also could cause false positives. Choices = relax and common, default is common
--pcovs: Minimum percent coverage of spacer sequence, default is 0.9.
--pident: Minimum percent identity of spacer sequence, default is 0.9.
--rident: Minimum percent identity of repeat sequence, default is 0.8.
--MaxProteinNumber: Maximum number of protein homologs, default is 20. If the size is too large, NCBI will forbidden your request.
Install the required Python packages:
pip install argparse biopython pyfaidx urllib3 requests func_timeoutInstall WebLOGO and seqkit, and ensure they are added to your PATH.
python pamphlet.py -s spacers.fa -o output_directorySpecify additional parameters as needed, here is an example with input protein alignment tabular txt file
python pamphlet.py -s spacers.fasta -r GCTAGTGTAGCTGTCAGTCGATGTCAC -P proteins_alignment.tabular.txt -l 1092 -O positive -u -R a -b relax -d prokaryote --pcovs 0.9 --pident 0.9 --rident 0.9 --MaxProteinNum 20Specify additional parameters as needed, here is an example with input protein sequence fasta file
python pamphlet.py -s spacers.fasta -r GCTAGTGTAGCTGTCAGTCGATGTCAC -p protein_sequence.fasta -O positive -u -R a -b relax -d prokaryote --pcovs 0.9 --pident 0.9 --rident 0.9 --MaxProteinNum 20Here we recommend preparing the protein BLAST tabular text file prior to executing PAMPHLET.
spacers.fasta: Contains spacer sequences
proteins_alignment.tabular.txt: Contains cas protein blastp tabular results (from NCBI blastp result)
repeat_sequences: Input repeat sequences, only need to paste sequence to the CMD.
Results will be saved in the specified output directory.
Generated WebLOGO plots and PAM predictions will be available for further analysis.
We recommend preparing the protein BLAST tabular text file prior to executing PAMPHLET, as this practice can save computational time. While utilizing PAMPHLET for blastp is also feasible, repeated use may lead to increased time for individual BLAST operations. Therefore, to conserve online BLAST resources, please complete the protein homology search using BLAST in advance.