Goosang-Yu/genet

Make python function of ViennaRNA fold_compound

Closed this issue · 7 comments

Goosang-Yu commented
  1. Function fold_compound of ViennaRNA can not be used in Windows OS
  2. For only this function, we should ViennaRNA, which can make some installation error.

Example usage:

from RNA import fold_compound

InputSeq = 'ACGCGTATTATGCGCAGCTATC' # sequence (str)

sDBSeq, fMFE = fold_compound(InputSeq).mfe() # fMFE is what we want to get

Could we make python function which can return same output of fold_compound?

Source code (C lang):
https://github.com/ViennaRNA/ViennaRNA/blob/master/src/ViennaRNA/fold_compound.c

Can you tell me your opinion, @ntfargo ?

Goosang-Yu commented

Please also see ViennaRNA/interfaces/mfe.dox

/**

@fn float vrna_mfe(vrna_fold_compound_t *fc, char *structure)
@scripting
@parblock
This function is attached as method `mfe()` to objects of type `fold_compound`.
The parameter @p structure is returned along with the MFE und must not be provided.
See e.g. @rstinline:py:meth:`RNA.fold_compound.mfe()` in the :doc:`/api_python`@endrst.
@endparblock
ntfargo commented

Okay thanks i will check!

  • 👍1
ntfargo commented

Okay so, as i see ViennaRNA is primarily designed for unix-based systems.

I need more time to research this issue; maybe I will make a sub-repository to test these things.

&attachment
https://www.tbi.univie.ac.at/RNA/ViennaRNA/refman/examples/python.html
https://www.tbi.univie.ac.at/RNA/download/win/windows/Install-ViennaRNA-2.6.2_64bit.exe (precompiled Binary Package / PATH variable needs to add system vars)

Goosang-Yu commented

Thank you @ntfargo ,

As you mentioned, ViennaRNA has a Python API, which I've been using so far.
However, this API has two issues:

  1. It doesn't install on Windows OS because there are no precompiled versions available for Windows.
    2/ ViennaRNA sometimes fails to install or import the module (import RNA), and I'm not sure why.

One more thing that concerns me is that calculating from DNA/RNA sequence (input; str) -> fold_compound -> MFE is a bit slow. What I need is only the MFE, so it would be great if I could create a compact function that calculates just the MFE, removing any unnecessary calculation steps to speed it up.

If it's too complicated, just making ViennaRNA's fold_compound.mfe() work on Windows OS would be a significant help.
I'll keep looking into it, and I'll get back to you.

Thank you!

  • 👍1
ntfargo commented

Creating a special fold_compound.mfe() can be quite complex and challenging, but with the right effort and determination, it's possible to develop a highly stable algorithm. However, for a smoother experience on Windows OS, I still recommend using Windows Subsystem for Linux (WSL).

  • 👍1
ntfargo commented

Any news about this idea?

Goosang-Yu commented

No idea for ViennaRNA implementation with only python.
The best way is using WLS as you said or not using RNA 2ndary folding as DeepPrime feature.

  • 👍1