RabbitIO-Ktrim is an enhanced version of Ktrim based on RabbitIO.
you can re-compile the programs:
git clone https://github.com/RabbitBio/RabbitIO-Ktrim.git
cd RabbitIO-Ktrim
make clean && make
Usage: Ktrim [options] -1/-U Read1.fq [ -2 Read2.fq ] -o out.prefix
RabbitIO-Ktrim is an enhanced version of Ktrim based on RabbitIO.
Compulsory parameters:
-1/-U Read1.fq Specify the path to the files containing read 1
If your data is Paired-end, use '-1' and specify read 2 files using '-2' option
Note that if '-U' is used, specification of '-2' is invalid
If you have multiple files for your sample, use ',' to separate them
Gzipped files are supported from version 1.2.0
-o out.prefix Specify the prefix of the output files
Note that output files include trimmed reads in FASTQ format and statistics
Optional parameters:
-2 Read2.fq Specify the path to the file containing read 2
Use this parameter if your data is generated in paired-end mode
If you have multiple files for your sample, use ',' to separate them
and make sure that all the files are well paired in '-1' and '-2' options
-t threads Specify how many threads should be used (default: 1, single-thread)
You can set '-t' to 0 to use all threads (automatically detected)
-p phred-base Specify the baseline of the phred score (default: 33)
-q score The minimum quality score to keep the cycle (default: 20)
Note that 20 means 1% error rate, 30 means 0.1% error rate in Phred
-w window Set the window size for quality check (default: 5)
Ktrim will stop when all the bases in a consecutive window pass the quality threshold
Phred 33 ('!') and Phred 64 ('@') are the most widely used scoring system
Quality scores start from 35 ('#') in the FASTQ files is also common
-s size Minimum read size to be kept after trimming (default: 36; must be larger than 10)
-k kit Specify the sequencing kit to use built-in adapters
Currently supports 'Illumina' (default), 'Nextera', 'Transposase' and 'BGI'
-a sequence Specify the adapter sequence in read 1
-b sequence Specify the adapter sequence in read 2
If '-a' is set while '-b' is not, I will assume that read 1 and 2 use same adapter
Note that '-k' option has a higher priority (when set, '-a'/'-b' will be ignored)
-m proportion Set the proportion of mismatches allowed during index and sequence comparison
Default: 0.125 (i.e., 1/8 of compared base pairs)
-h/--help Show this help information and quit
-v/--version Show the software version and quit
Please refer to README.md file for more information (e.g., setting adapters).
RabbitIO-Ktrim: enhanced extra-fast and accurate adapter- and quality-trimmer based on Ktrim.
Ktrim
contains built-in adapter sequences used by Illumina TruSeq kits, Nextera kits, Nextera transposase
adapters and BGI sequencing kits within the package. However, customized adapter sequences are also allowed
by setting '-a' (for read 1) and '-b' (for read 2; if it is the same as read 1, you can left it blank)
options. You may need to refer to the manual of your library preparation kit for the adapter sequences.
Note that in the current version of Ktrim
, only 1 pair of adapters is allowed.
Here are the built-in adapter sequences (the copyright should belong to the corresponding companies):
Illumina TruSeq kits:
AGATCGGAAGAGC (for both read 1 and read 2)
Nextera kits (suitable for ATAC-seq data):
CTGTCTCTTATACACATCT (for both read 1 and read 2)
BGI adapters:
Read 1: AAGTCGGAGGCCAAGCGGTC
Read 2: AAGTCGGATCGTAGCCATGT
Your data is generated using Illumina TruSeq kit in Single-end mode, then you can run:
./RabbitIO-Ktrim -U /path/to/read1.fq -o /path/to/output/dir
Your data is generated using a kit with customized adapters; your data is composed of 3 lanes in Paired-end mode and uses Phred scoring system starts from 35; you want to keep the high quality (Phred score >=30) bases and reads longer than 50 bp after trimming; and you want to use 4 threads to speed-up the analysis, then you can run:
./RabbitIO-Ktrim -1 /path/to/lane1.read1.fq.gz,/path/to/lane2.read1.fq.gz,/path/to/lane3.read1.fq \
-2 /path/to/lane1.read2.fq.gz,/path/to/lane2.read2.fq.gz,/path/to/lane3.read2.fq \
-t 4 -p 35 -q 30 -s 50 -o /path/to/output/dir \
-a READ1_ADAPTER_SEQUENCE -b READ2_ADAPTER_SEQUENCE
Under the testing_dataset/
directory, a script named simu.reads.pl
is provided to generate in silico
reads for testing purpose only. Note that the results in the paper is based on the data generated by this
script. Another script check.accuracy.pl
is designed to evaluate the accuracies of the trimming tools.
Ktrim
outputs the trimmed reads in FASTQ format and key statistics (e.g., the numbers of reads that
contains adapters and the number of reads in the trimmed files).
This is a case study of our RabbitIO project.