RNAcentral/rnacentral-sequence-search

Pagination still returns duplicated pages sometimes

BurkovBA opened this issue · 2 comments

Search for:

CUAUACAAUCUACUGUCUUUC

You'll find multiple entries of Anolis carolinensis let-7 microRNA precursor URS00006C9229_28377

Not sure if this is a pagination problem. I created a script to look for duplicate entries and this error does not occur when we use a single file for all-except-rrna and a single file for whitelist-rrna.

I can see multiple entries when we split these files. @AntonPetrov can you tell me if what I am doing makes sense? I will be happy to chat about this if you want.

This does not happen anymore - closing.