Explicitly explain reverse orientation location interpretation
Closed this issue · 0 comments
jakebeal commented
We don't currently explain which way people should interpret a reverse orientation location.
We should explain that we are using the GenBank style interpretation in which the reversing happens after the range selection (rather than the opposite order). For example, in the following sequence:
AAAAACCCCCTTTTTGGGGGTTTTTGGGGG
Range: 1-6, reverse will get you "AAAAAC" to be reverse complemented to "GTTTTT"