/LinearFold

The new source code of the LinearFold, linear-time prediction for RNA secondary structures

Primary LanguageC++OtherNOASSERTION

This codebase replaces the now deprecated version: https://github.com/abentu0101/LinearFold. This version fixes many bugs and design problems in the old version.

LinearFold: Linear-Time Prediction for RNA Secondary Structures

This repository contains the C++ source code for the LinearFold project, the first linear-time prediction algorithm/software for RNA secondary structures.

LinearFold: Linear-Time Approximate RNA Folding by 5’-to-3’ Dynamic Programming and Beam Search. Bioinformatics, Volume 35, Issue 14, July 2019, Pages i295–i304. ISMB 2019

Liang Huang*, He Zhang**, Dezhong Deng**, Kai Zhao, Kaibo Liu, David Hendrix, David Mathews

* corresponding author

** contributed equally

Web server: http://linearfold.org

Dependencies

GCC 4.8.5 or above; python2.7

To Compile

make

To Run

The LinearFold parser can be run with:

echo SEQUENCE | ./linearfold [OPTIONS]

OR

cat SEQ_OR_FASTA_FILE | ./linearfold [OPTIONS]

Both FASTA format and pure-sequence format are supported for input.

OPTIONS:

-b BEAM_SIZE

The beam size (default 100). Use 0 for infinite beam.

-V

Switches LinearFold-C (by default) to LinearFold-V.

--verbose

Prints out energy of each loop in the structure. (default False)

--sharpturn

Enable sharpturn in prediction. (default False)

--eval

Enable eval mode, which can calculate free energy for a given structure of a sequence. (default False)

--constraints

Enable adding specific constraints in prediction (default False). The constraint sequence should have the same length as the RNA sequence. "? . ( )" indicates a position for which the proper matching is unknown, unpaired, left or right parenthesis respectively. The parentheses must be well-banlanced and non-crossing.

To Visualize

LinearFold is able to visualize the structure using a circular plot.

To draw a circular plot, run command:

cat TARGET_FILE | ./draw_circular_plot 

TARGET_FILE contains one sequence and its structure; see "ecoli_tRNA" file as an example.

Example Run Predict

cat testseq | ./linearfold
UGAGUUCUCGAUCUCUAAAAUCG
....................... (-0.22)
AAAACGGUCCUUAUCAGGACCAAACA
.....((((((....))))))..... (4.91)
AUUCUUGCUUCAACAGUGUUUGAACGGAAU
.............................. (-0.29)
UCGGCCACAAACACACAAUCUACUGUUGGUCGA
(((((((...................))))))) (0.99)
GUUUUUAUCUUACACACGCUUGUGUAAGAUAGUUA
.....(((((((((((....))))))))))).... (6.66)

echo GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA | ./linearfold -V -b 20
GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA
(((((((..((((.......))))((((((((...)))))))).(((((.......)))))))))))).... (-31.50)

Example Run Predict with constraints

cat testcons | ./linearfold --constraints
AACUCCGCCAGGCCUGGAAGGGAGCAACGGUAGUGACACUCUCUGUGUGCGUAGGUUGCCUAGCUACCAUUU
??(???(??????)?(????????)???(??????(???????)?)???????????)??.???????????
..(.(((......)((........))(((......(.......).))).....))..).............. (-27.33)
GCCUGGUGACCAUAGCGAGUCGGUACCACCCCUUCCCAUCCCGAACAGGACCGUGAAACGACUCCGCGCCGAUGAUAGUGCGGAUUCCCGUGUGAAAGUAGGUCAUCGCCAGGC
??(??(???(??????)???????????????(????)???(???????????(??(????.)??????????(??????)?)??????)????????????)????????)??
(((((((..(......).........(((...(....)...((....(((...(..(.....)..........(......).)..))))).))).......))))......))) (-44.00)

echo -e "GAACCCCGUCAGGUCCGGAAGGAAGCAGCGGUAAGU\n??????????????????(????????????????)" | ./linearfold --constraints
GAACCCCGUCAGGUCCGGAAGGAAGCAGCGGUAAGU
??????????????????(????????????????)
..................(................) (-8.85)

echo -e "GAACCCCGUCAGGUCCGGAAGGAAGCAGCGGUAAGU\n??????????????????(????????????????)" | ./linearfold --constraints -V
GAACCCCGUCAGGUCCGGAAGGAAGCAGCGGUAAGU
??????????????????(????????????????)
.....(((.......)))(.....((....))...) (3.70)

Example Run Eval

cat testeval | ./linearfold --eval
UGAGUUCUCGAUCUCUAAAAUCG
.(((........)))........ (-1.80)
AAAACGGUCCUUAUCAGGACCAAACA
.....((((((....))))))..... (-9.30)
AUUCUUGCUUCAACAGUGUUUGAACGGAAU
(((((...(((((......))))).))))) (-6.80)
UCGGCCACAAACACACAAUCUACUGUUGGUCGA
(((((((((..............))).)))))) (-7.80)
GUUUUUAUCUUACACACGCUUGUGUAAGAUAGUUA
....((((((((((((....))))))))))))... (-13.00)

echo -e "GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA\n(((((((..((((.......))))((((((((...)))))))).(((((.......))))))))))))....\n" | ./linearfold --eval --verbose
Hairpin loop ( 13, 21) CG : 4.50
Interior loop ( 12, 22) UA; ( 13, 21) CG : -2.40
Interior loop ( 11, 23) AU; ( 12, 22) UA : -1.10
Interior loop ( 10, 24) GC; ( 11, 23) AU : -2.40
Hairpin loop ( 32, 36) UA : 5.90
Interior loop ( 31, 37) UA; ( 32, 36) UA : -0.90
Interior loop ( 30, 38) CG; ( 31, 37) UA : -2.10
Interior loop ( 29, 39) CG; ( 30, 38) CG : -3.30
Interior loop ( 28, 40) UA; ( 29, 39) CG : -2.40
Interior loop ( 27, 41) UA; ( 28, 40) UA : -0.90
Interior loop ( 26, 42) CG; ( 27, 41) UA : -2.10
Interior loop ( 25, 43) GC; ( 26, 42) CG : -3.40
Hairpin loop ( 49, 57) GC : 4.40
Interior loop ( 48, 58) GC; ( 49, 57) GC : -3.30
Interior loop ( 47, 59) GC; ( 48, 58) GC : -3.30
Interior loop ( 46, 60) UA; ( 47, 59) GC : -2.10
Interior loop ( 45, 61) CG; ( 46, 60) UA : -2.10
Multi loop ( 7, 62) GC : 1.40
Interior loop ( 6, 63) CG; ( 7, 62) GC : -2.40
Interior loop ( 5, 64) UA; ( 6, 63) CG : -2.40
Interior loop ( 4, 65) CG; ( 5, 64) UA : -2.10
Interior loop ( 3, 66) GU; ( 4, 65) CG : -2.50
Interior loop ( 2, 67) GC; ( 3, 66) GU : -1.50
Interior loop ( 1, 68) GC; ( 2, 67) GC : -3.30
External loop : -1.70
GGGCUCGUAGAUCAGCGGUAGAUCGCUUCCUUCGCAAGGAAGCCCUGGGUUCAAAUCCCAGCGAGUCCACCA
(((((((..((((.......))))((((((((...)))))))).(((((.......)))))))))))).... (-31.50)

Example: Draw Circular Plot

cat ecoli_tRNA | ./draw_circular_plot