/ssUMI

Primary LanguageShell

ssUMI

A workflow for utilizing unique molecular identifiers (UMIs) for error-correction of small subunit (SSU) rRNA (e.g. 16S rRNA) gene amplicons on the Nanopore platform. This workflow is a branch of the longread_umi pipeline, and has been taylored for 16S rRNA gene sequencing with newer Nanopore sequencing chemistry (>= R.10.4).

Table of contents

Citations
Lin, Xuan, Kate Waring, John Tyson, Ryan M. Ziels. (2023) High-accuracy meets high-throughput for microbiome profiling with near full-length 16S rRNA amplicon sequencing on the Nanopore platform. bioRxiv.

Karst, Søren M., Ryan M. Ziels, Rasmus H. Kirkegaard, Emil A. Sørensen, Daniel McDonald, Qiyun Zhu, Rob Knight, and Mads Albertsen. (2021) High-accuracy long-read amplicon sequences using unique molecular identifiers with Nanopore or PacBio sequencing. Nat Methods 18, 165–169 (2021). https://doi.org/10.1038/s41592-020-01041-y

Installation

  1. Install the longread_umi package

  2. Determine the location of the package contents. For instance, if longread_umi was installed via conda, type:

    conda activate longread_umi
script_path="`echo "$CONDA_PREFIX/longread_umi"`"
conda deactivate

  3. Download the ssUMI scripts:

git clone https://github.com/ZielsLab/ssUMI.git

  1. Replace the longread_umi scripts folder with the new (ssUMI) scripts folder

    mv $script_path/scripts $script_path/scripts_old
mv path/to/ssUMI/scripts $script_path/
chmod +x $script_path/scripts/*

  2. Download VSEARCH

  3. Install medaka via a virtual environment, and add new medaka model files: (see https://github.com/nanoporetech/medaka for details)

    cd /path/to/medaka

python3 -m venv medaka --prompt "medaka"
source medaka/bin/activate
pip install --upgrade pip
pip install medaka
medaka tools download_models
deactivate

  4. Edit the file $script_path/scripts/dependencies.sh

    Replace part of this line:

    export VSEARCH="/path/to/vsearch"

    with your file path to your VSEARCH installation.

    Then, replace part of this line:

    export USEARCH="/path/to/usearch"

    with the path to your USEARCH environment (installed as part of longread_umi)

    Finally, replace part of this line:

    export MEDAKA_ENV_START="source /path/to/medaka/bin/activate"

    with the paths to your medaka virtual environment (e.g. leave the source activate part).

    Test data

    It is highly recommended that users test their installation and ssUMI scripts using the test data found in the test_data folder within the cloned ssUMI repository. Code for running the ssUMI pipeline on test_data.fastq is given below in Usage. The expected output is a fasta file containing 4 UMI-based consensus sequences.

Usage

longread_umi ssumi_rapid: run the ssUMI pipeline for consensus polishing of UMI-tagged 16S rRNA gene amplicons in 'rapid' mode, with just (-c) rounds of Racon polishing (recommended number of rounds = 3).

longread_umi ssumi_std: run the ssUMI pipeline for consensus polishing of UMI-tagged 16S rRNA gene amplicons in 'standard' mode, with just (-c) rounds of Racon polishing (recommended value = 3), then (-p) rounds of Medaka (recommended value = 2), followed by a final round of Racon polishing. 

usage: 
ssumi_std [-h]  (-d file -v value -o dir -s value) 
(-e value -m value -M value -f string -F string -r string -R string )
( -c value -p value -n value -u dir -t value -T value ) 

ssumi_rapid [-h] (-d file -v value -o dir -s value) 
(-e value -m value -M value -f string -F string -r string -R string )
( -c value -n value -u dir -t value )

where:
    -h  Show this help text.
    -d  Single file containing raw Nanopore data in fastq format.
    -v  Minimum read coverage for using UMI consensus sequences for 
        variant calling.
    -o  Output directory.
    -s  Check start of read up to s bp for UMIs.
    -e  Check end of read up to f bp for UMIs.
    -m  Minimum read length.
    -M  Maximum read length.
    -f  Forward adaptor sequence. 
    -F  Forward primer sequence.
    -r  Reverse adaptor sequence.
    -R  Reverse primer sequence.
    -c  Number of iterative rounds of consensus calling with Racon.
    -p  Number of iterative rounds of consensus calling with Medaka.
    -q  Medaka model used for polishing. r941_min_high, r10_min_high etc.
    -u  Directory with UMI binned reads.
    -t  Number of threads to use.
    -T  Number of medaka jobs to start. Threads pr. job is threads/jobs.
        [Default = 1].

Example Usage

Below is an example usage for V1-V9 16S rRNA gene amplicons generated with UMI-tagged 8F / 1391R UMI primers and an ONT R.10.4 flowcell and basecalled with guppy v6.3.8. The raw ONT reads would be given by INFILE (e.g. INFILE="path/to/raw/reads"), the desired output folder specified by OUTDIR (e.g. OUTDIR="path/to/output"), and the number of threads by THREADS (e.g. THREADS=16).

longread_umi ssumi_std \
  -d ${INFILE} \
  -v 3 \
  -o ${OUTDIR} \
  -s 200 \
  -e 200 \
  -E 0.1 \
  -m 1200 \
  -M 2000 \
  -f GTATCGTGTAGAGACTGCGTAGG \
  -F AGRGTTYGATYMTGGCTCAG \
  -r AGTGATCGAGTCAGTGCGAGTG \
  -R GACGGGCGGTGWGTRCA \
  -c 3 \
  -p 2 \
  -q r104_e81_sup_g610 \
  -t ${THREADS} \
  -T ${THREADS}