beliveau-lab/OligoMiner

Hidden readline not remove in fasta header

Closed this issue · 1 comments

pawlowac commented

Pretty self explanatory. Seems you need chrom = chrom.strip() to prevent readlines from messing with the fastq file. Bowtie2 handles it well, but any other parsing of the fastq file throws an error since probe position is on a new line.

Right now producing:

@NZ_CP00
:54-94
TAAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGC
+
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

And not:

@NZ_CP00:54-94
TAAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGC
+
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
conorcamplisson commented

Hi Andrew,

Thanks for reaching out about this!

I am trying to reproduce this issue locally; would you kindly provide:

  • a small fasta file that results in this fastq output when run through blockParse.py
  • the output of python --version command
  • your operating system

I have also started an issue_12_dev branch and attempted to implement the change you suggested. To test this change on your end:

$ git pull
$ git checkout issue_12_dev

and then you should be able to run the modified blockParse.py and see if it resolves the issue on your files.

Once I'm able to reproduce the issue and test a solution, I'll go ahead and merge the changes. Thanks again!

Best,

Conor Camplisson