Issues
- 1
Fix vcf-to-hgvs protein to handle initiation or stop codon variant more precisely
#97 opened by nokara26 - 0
NullPointerException case in vcf-variant->hgvs
#107 opened by federkasten - 1
Failed to convert long deletion including stop codon chr17:80090386 CAGCACGTGCATGAACAACACAGGACACACACAGCACGTGCATGAACAACACAGGACACACACA>C
#95 opened by federkasten - 2
prefer-deletion-insertion? option
#94 opened by federkasten - 0
- 1
Out of position when converting vcf to hgvs
#74 opened by nokara26 - 0
StringIndexOutOfBoundsException in apply-3'-rule
#72 opened by nokara26 - 1
`vcf-variants->hgvs` omits trailing `fs*`
#58 opened by k-kom - 0
Convert ATM c.2465del correctly
#49 opened by federkasten - 3
Don't work hgvs->vcf-variants in some case
#39 opened by kbaba1001