The CP(ython)ExpectedDistance is a Module to calculate Expected Distances of terminal on the ensemble of RNA Structures. Under the hood it uses the ViennaRNA C API as well as the numpy API to create an expected Distance matrix.
The idea is from the paper:
@article{Clote2012ExpectedDB,
title={Expected distance between terminal nucleotides of RNA secondary structures},
author={Peter Clote and Yannick Ponty and Jean-Marc Steyaert},
journal={Journal of Mathematical Biology},
year={2012},
volume={65},
pages={581-599}
}
Installation should be as simple as
pip install cpexpecteddistanceWarning
Please Note that you need ViennaRNA to be installed. We recommend to install it via Conda
conda install -c bioconda viennarna
Warning
If you get any compiler errors try to use a conda environment and install g++ there via:
conda install -c conda-forge gxx
Afterwards you should be able to use the functionality as follows:
from CPExpectedDistance import expected_distance
import RNA
seq = "AAUGCUGAACGUAGCUACGAUCGAUCGACG"
fc = RNA.fold_compound(seq)
array = expected_distance(fc)
terminal_distance = array[0, -1]The expected_distance function is fully compatible with the ViennRNA Python API, thus you can
change the model details for folding as usual.
For example you can change the folding temperature as follows:
from CPExpectedDistance import expected_distance
import RNA
seq = "AAUGCUGAACGUAGCUACGAUCGAUCGACG"
md = RNA.md(temperature=20)
fc = RNA.fold_compound(seq, md)
array = expected_distance(fc)
terminal_distance = array[0, -1]In case you are using This software for your publications you may want to cite:
@article{lorenz2011viennarna,
title={ViennaRNA Package 2.0},
author={Lorenz, Ronny and Bernhart, Stephan H and H{\"o}ner zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F and Hofacker, Ivo L},
journal={Algorithms for molecular biology},
volume={6},
number={1},
pages={1--14},
year={2011},
publisher={Springer}
}