/LynxAligner

LynxAligner, is a sequence alignment software developed using Rust and the seed-extend algorithm

Primary LanguageRust

LynxAligner

Notice: This project is still under active development and not guaranteed to have a stable API.

LynxAligner, inspired by the agility and precision of a lynx, is a sequence alignment software developed using Rust and the seed-extend algorithm, designed for efficient and accurate bioinformatics data analysis.

The seed-extend model is a popular approach in bioinformatics for sequence alignment, especially useful for handling large genomic datasets efficiently. This model typically works in two stages:

  • Seed: Identifies short, exact matches (seeds) between two sequences or within a database. These seeds are potential starting points for longer alignments.

  • Extend: Expands these seeds in both directions, aligning additional nucleotides until the alignment score falls below a certain threshold.

This approach is effective in balancing the speed (by quickly identifying potential alignment regions through seeding) and accuracy (by extending and scoring these regions) of the alignment process.

Install

# Cargo.toml
[dependencies]
aligners = {git="https://github.com/dongspy/aligners.git"}

Usage

use bio::alignment::pairwise::Scoring;
use aligners::aligner::Aligner;

fn main() {
    let refs = ["CCCCACGTCCACGTGGGGGGA", "ACGTACGTACGTGGGGG"];

    let scoring = Scoring::from_scores(-4, -2, 2, -2).xclip(-5).yclip(0);
    let aligner = Aligner::new(&refs, scoring, 8, 8);
    let reads = vec![
        "CCCACCTACGTGGG",
    ];
    let matches = aligner.find_read_matches(reads[0], 15);
    dbg!(matches);
}