wrnap (w(RNA)p)
A simple gem for facilitating bindings to various RNA CLI packages (namely http://www.tbi.univie.ac.at/~ivo/RNA/). Note that this gem makes no effort to build and install any wrapped packages at install-time, and instead relies on its presence on the host machine. Also includes a lot of utilities surrounding RNA sequence / structure parsing, graphing using R (via RinRuby) and other analysis tools. Used privately as the foundation for much of the research I do at http://bioinformatics.bc.edu/clotelab/
Installation
Add this line to your application's Gemfile:
gem 'wrnap'
And then execute:
$ bundle
Or install it yourself as:
$ gem install wrnap
Usage
Simple use case:
> require "wrnap"
#=> true
> rna = Wrnap::Package::Fold.run(seq: "CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG")
#=> #<Wrnap::Fold:0x007f9c48839dc0>
> rna.structure
#=> "((((..(((...(((....))).)))..))))"
> rna.mfe
#=> -19.7
... now an even easier way ...
> mfe_rna = RNA("CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG").run(:fold).mfe_rna
#=> echo CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG | rnafold --noPS
#=> Total runtime: 0.013 sec.
#=> #<Wrnap::Rna CCUCGAGGGGAACCCGAAAG... ((((..(((...(((....) [truncated]>
Contributing
- Fork it ( https://github.com/[my-github-username]/wrnap/fork )
- Create your feature branch (
git checkout -b my-new-feature
) - Commit your changes (
git commit -am 'Add some feature'
) - Push to the branch (
git push origin my-new-feature
) - Create a new Pull Request