TR-solve is a tool for determining the structure of repeat alleles. It works by first finding putative motifs and then labeling the runs of these motifs within the given allele sequence. The last step is accoplished using a Hidden Markov Model (HMM).
TR-solve binaries are available here.
The tool accepts reads sequences from the standard input and then outputs a list of motifs and their spans. For example let's apply TR-solve to CAGCAGCAGCATCATCATCAT like so:
$ echo "CAGCAGCAGCATCATCATCAT" | ./tr-solve
CAGCAGCAGCATCATCATCAT CAG(0-9),CAT(9-21)The output consists of the original sequence and the motif list CAG(0-9),CAT(9-21). It tells us that TR-solve found runs of two motifs, CAG and CAT. The run of CAGs spans the first nine bases of the query sequence and the run of CATs spans the rest.