RNAnue is a comprehensive analysis to detect RNA-RNA interactions from Direct-Duplex-Detection (DDD) data.
RNAnue has the following dependencies, whereas the brackets indicate the version RNAnue has been build and tested on. Make sure the requirements are satified by your system. cmake is able to detect the Boost libraries system-wide. However seqan is expected to be located in the parent folder of RNAnue as specified in the CMakeLists.txt. Segemehl and the Vienna binaries need to be located in $PATH.
- Boost C++ Libraries (v1.7.2)
- SeqAn (v3.0.2)
- Segemehl (v0.3.4)
- Vienna Package (v2.4.17)
- OpenMP v12.0.0
CMake is a cross-platform Makefile generator. For that, we provide the CMakeLists to simplify the build process. In particular, it utilizes the instructions given in the CMakeLists. It is recommended to create a "out-of-source build". For that, create a build folder (e.g., ./bin) and cmake into the root directory.
cmake ../source/
This is be sufficient if the dependencies are located in $PATH. Calling make
builds RNAnue.
RNAnue provides different functional arguments (subcalls) for individual procedures. These include RNAnue preproc
,
RNAnue align
, RNAnue clustering
, RNAnue analysis
. In additon, RNAnue complete
applies the whole workflow.
RNAnue requires the sequencing files to be in a specific folder structure. The root folders of the treatments (--trtms) and controls (--ctrls) are specified accordingly. These folders contain subfolders with arbitrary conditions (e.g., treatment, cell lines,...) that in turn contain the read files, e.g.,
./trtms/
condition1
condition2
./ctrls
condition1
condition2
It is to be noted that the --trtms
needs to be specified. However, --ctrls
may be not set (optional).
RNAnue accepts parameter settings both from the commandline and through a configuration file. For the latter, we provide a template configuration file (params.cfg) that allows to set the parameters in a more convenient fashion. This means that the call of RNAnue is reduced to the following call.
RNAnue <subcall> --config /path/to/params.cfg
Here, subcall corresponds to positional arguments.In any case, the specifying parameters over the command lines has precedence over the config file.
In principle, the results of the analysis are stored in the specified output folder and its subfolders (e.g., ./preproc, ./align, ./clustering, ./analysis). RNAnue reports the split reads in SAM format, the clusters and the RNA-RNA interactions. RNAnue reports the split reads in SAM format. Additionally, the complementarity scores and hybridization energies are stored in the tags FC and FE, respectively. We report the clusters in a custom format that includes the IDs of the clusters, its length, size and genomic coordinates.
RNAnue reports the detected splits in .SAM format (RNAnue detect
). In this file, pairs of rows represent the
split reads, consisting of the individual segments, e.g
A00551:29:H73LYDSXX:1:1101:7274:10645 16 gi|170079663|ref|NC_010473.1| 3520484 22 1X51= * 0 0 AGGGGTCTTTCCGTCTTGCCGCGGGTACACTGCATCTTCACAGCGAGTTCAA * XA:Z:TTTCTGG XC:f:0.714286 XE:f:-15.6 XL:i:7 XM:i:5 XN:i:0 XR:f:0.0735294 XS:i:5 XX:i:1 XY:i:52
A00551:29:H73LYDSXX:1:1101:7274:10645 16 gi|170079663|ref|NC_010473.1| 3520662 22 11=5S * 0 0 TTCGATCAAGAAGAAC * XA:Z:GAAGAAC XC:f:0.714286 XE:f:-15.6 XL:i:7 XM:i:5 XN:i:0 XR:f:0.0735294 XS:i:5 XX:i:53 XY:i:68
In the following the tags are listed that are reported in the detected split reads. Please note that in the upper segment the alignment is in reverse as done in the calculation of the complemtarity to represent the 3'-5' and 5'-3' duplex.
tag | description |
---|---|
XC:f | complementarity |
XL:f | length of alignment |
XR:f | site length ratio |
XM:i | matches in alignment |
XA:Z | alignment of sequence |
XE:f | hybridization energy |
In additon, we provide a ready-to-use Docker container that has RNAnue preconfigured. https://hub.docker.com/repository/docker/cobirna/rnanue
contact cobi@ibvt.uni-stuttgart.de or create an issue