######################################################################################################################################################################## ########################################################################################################################################################################
SEQUENCE REPETITION FINDER_v1 is a python script useful to define the percentage of repetitions of DNA sequences in FASTA format. After the uploading of a fasta sequence (see fasta format example in the file: sequence.fasta) it reads from file:
- the name of the sequence (in the example is PCR10: >chr1:0-100 PCR10)
- the sequence string.
As a default setting, it searches, for upload sequences, 3 or more repetitions of N-bases (bp) and counts their occurrences. The N-bases windows searched ranging with the default cut-off from 1 to 10. As an example to understand how it works, in the input string 'aggaaaatctctcggggtata', it searches the following number of N-bases:
- N-bases: 10 bp -> none repetitions of 10 bp found;
- N-bases: 9 bp -> none repetitions of 9 bp found;
- N-bases: 8 bp -> none repetitions of 8 bp found;
- N-bases: 7 bp -> none repetitions of 7 bp found;
- N-bases: 6 bp -> none repetitions of 6 bp found;
- N-bases: 5 bp -> none repetitions of 5 bp found;
- N-bases: 4 bp -> none repetitions of 4 bp found;
- N-bases: 3 bp -> none repetitions of 3 bp found;
- N-bases: 2 bp -> 3 repetitions of 2 bases 'TC' found 1 time in the full string. They are represented in upper case: aggaaaaTCTCTCggggtata.
- N-bases: 1 bp -> 4 repetitions of 1 bases counted 2 times in string. The first repetitions is 'AAAA' and the second 'GGGG'. The single base repetitions counted are represented in upper case: aggAAAATCTCTCAAAAtata. NOTE: the 'gg' and 'tata' repetitions in string, are not recognized beacuse are only 2 repetitions (2x 'g' and 2x 'tc').
LAUNCH TOOL:
- make a new folder containing the fasta input file (sequence.fasta) and sequence_repetition_finder.py, launch the pipeline inserting the custom file, change the input name in file variable (variable FILE, script 2)string_complexity_computing_v1.py;
- Check the excel output file in the folder.
INPUT FILE:
- fasta file: see the example of the sequence.fasta in the folder.
- IMPORTANT: it accepts only strings with a,c,g,t characters in lower or upper case.
FILE
OUTPUT FILE LEGEND:
- COLUMN name= type of repetitions ex: 1bp x3= aaa other 3 single nucleotides 2bp x3= tatata other 2 random bases 3bp x4= tcctcctcctcc other 3 random not repeated bases etcc..
'2) COLUMN elements= number of times that the repetition described in the column name, is occurred in the sequence (identified in ID) (exaple 2bp x3rep found n time in the full sequence)
'3) COLUMN 'amplicon size'= is the size of the amplicon.
'4) COLUMN '%duplicate sequence'= percentage of the duplicated base in the sequence.