Optipyzer

A fast and flexible codon optimization tool. Optipyzer is capable of codon-optimizing both DNA and peptide sequences for multiple species at once while giving prefernce to certain species. The optimizer is hosted as a publically available web server with both a web-interface and a python programming interface for one-off queries or more high-throughput frameworks.

Web Application

The web-interface can be found at optipyzer.com. The site is intended to be used for simple, one-off queries. It provides a sequence input box and a species selection tool to choose your species and designate weightings. You can search through our database and specify any species you want.

Python API

For convenience, we have also written a small python package for an easier to use interface in high-throughput workflows. The package is a basic wrapper around our server that exposes convenience functions to interface the optimization server and make calls for you.

Install

pip install optipyzer

Example Usage

import optipyzer

# initalize API
op = optipyzer.api()

# search for e. coli
result = op.search(name='Escherichia Coli')
orgs = result['organisms']
print(orgs)

# pull codons for e coli
codon_usage = op.pull_codons("16815")
print(codon_usage)

# optimize a sequence for both human
# and bacteria
seq = "ATGCGTACTAGTCAGTCAGACTGACTG"
weights = {
    "16815": 1, # e. coli
    "122563": 2 # human
}
result = op.optimize(
    seq, weights, seq_type='dna'
)

Local Optimization Server

Some users might be interested in optimizing sequences confidentially. That is, using a locally run server and not making HTTP requests to the public API. In addition, this increases speed and supports high-throughput workflows.

Because of this, a docker container was prepared to spin up the server locally. The docker container will run the optimzation server off your local machine and you can now use this to optimize sequences instead of making calls to the public server.

(i.e. The server now runs on localhost:8000)

To spin up:

docker build -t optipyzer .
docker run -p 8000:8000 optipyzer

Using the local server

Simply specify you want to run the optimizer locally when initializing an Optipyzer object in your scripts and your local server will then be used:

import optipyzer

# initalize API
op = optipyzer.api(local=True) # <--- specify a local instance

# search for e. coli
result = op.search(name='Escherichia Coli')
orgs = result['organisms']
print(orgs)

# pull codons for e coli
codon_usage = op.pull_codons("16815")
print(codon_usage)

# optimize a sequence for both human
# and bacteria
seq = "ATGCGTACTAGTCAGTCAGACTGACTG"
weights = {
    "16815": 1, # e. coli
    "122563": 2 # human
}
result = op.optimize(
    seq, weights, seq_type='dna'
)

Contributing

Issues, PR's, and contributions are always welcome. Please reach out (or open an issue) if you would like to contribute!

levandoskije/optipyzer