current version: 0.20
MIREAP combines small RNA position and depth with a model of microRNA biogenesis to discover microRNAs from deeply sequenced small RNA libraries.
-
Install Vienna RNA Package (http://www.tbi.univie.ac.at/RNA) on your computer and make sure that its perl interface (RNA.pm) is accessible.
-
Move mireap.tar.gz to a directory (/foo/bar) and uncompress:
tar -zxvf mireap*.tar.gz
Before running mireap, you need add path /foo/bar/mireap*/lib to environment variable PERL5LIB by:
In csh/tcsh:
setenv PERL5LIB /foo/bar/mireap_0.2/lib
In sh/ksh/bash:
export PERL5LIB=/foo/bar/mireap_0.2/lib
mireap.pl -i <smrna.fa> -m <map.txt> -r <reference.fa> -o <outdir>
Options:
-i <file> Small RNA library, fasta format, forced
-m <file> Mapping file, tabular format, forced
-r <file> Reference file, fasta format, forced
-o <dir> Directory where results produce (current directory)
-t <str> Sample label (xxx)
-A <int> Minimal miRNA sequence length (18)
-B <int> Maximal miRNA sequence length (26)
-a <int> Minimal miRNA reference sequence length (20)
-b <int> Maximal miRNA reference sequence length (24)
-u <int> Maximal copy number of miRNAs on reference (20)
-e <folat> Maximal free energy allowed for a miRNA precursor (-18)
-d <int> Maximal space between miRNA and miRNA* (35)
-p <int> Minimal base pairs of miRNA and miRNA*
-v <int> Maximal bulge of miRNA and miRNA* (4)
-s <int> Maximal asymmetry of miRNA/miRNA* duplex
-f <int> Flank sequence length of miRNA precursor (10)
-h Help
Please convert your small RNA file into fasta format and append sequencing frequence to sequence Id, just like this:
>t0000035 3234
GAATGGATAAGGATTAGCGATGATACA
t0000035 is sequence ID, 3234 is read count.
The format of small RNA mapping file should be tab-delimited by tab-delimited in the order:
read_ID, chr_ID, start, end, strand(+/-)
Note the start and end is one based.
Output format MIREAP produce three ouput files:
*.gff This file contains miRNA genes discovered by MIREAP, GFF3 format. For GFF3 format, please refer to http://www.sequenceontology.org/gff3.shtml Attribute 'Count' denotes the sequenceing frequence.
*.aln This file contains sequence and structure of the pre-miRNA. Small RNAs also are aligned to the precursor from which you can get more insights into the maturation process of miRNAs.
*.log This log file records parameters, start end time and other informations.
QIBIN LI (liqb@genomics.cn)
Please contact if you had new ideas to improve mireap or report a bug.
GPL v3