mirTransCNN

Detection and classification of pre-miRNA based on deep learning

Training

  • cross-validation for human datasets

python cv_human.py

  • cross-validation for cross-species data sets

python cv_whole.py

  • testing on human datasets

python main_human.py

Usage

python isMiRNA.py -s <RNAsequence> -m <model_path> -f <feature>

for example: python isMiRNA.py -s AGAAUUCUCUUAUCCAACAUCAACAUCUUGGUCAGAUUUGAACUCUUCAA -m model/human/model_cv_human_3.pkl -f feature_data/featureSelectedModel_cv_human_3.pkl

python isMiRNA.py -i <input file> -o <output file>

  • input file: fasta format

  • output file: txt format

  • model_path: the path of trained model

  • feature:Algorithm model for feature extraction

Dependencies

  1. Python >= 3.6
  2. RNAFold
  3. Pytorch
  4. Numpy

File

  1. data.zip
  • Datasets containing humans and cross-species
  1. feature_data.zip
  • The sequence feature set used in this experimental method, File names with "whole" represent cross-species, and those with "human" represent human.
  1. model
  • The path of trained model