Error in rule processONT

Question

Error in rule processONT

caonetto opened this issue a year ago · 23 comments

Getting this error when testing Verkko using duplex and simplex nanopore reads. The output of the "processONT.err" file is:
Step 1a
10000

Any ideas?

Thanks.

Answer 1 · 2023-08-30T14:24:07.000Z

What's the contents of the 4-processONT folder (ls -la to get file sizes)?

Answer 2 · 2023-08-31T00:18:23.000Z

Hi @skoren .
Thanks for your quick response. The content is

total 180904
drwxr-sr-x 2 conetto pawsey0912     4096 Aug 30 15:53 .
drwxr-sr-x 8 conetto pawsey0912     4096 Aug 30 15:53 ..
-rw-r--r-- 1 conetto pawsey0912 89508631 Aug 30 15:53 alns-ont-mapqfilter.gaf
-rw-r--r-- 1 conetto pawsey0912 89167606 Aug 30 15:53 alns-trimmed.gaf
-rw-r--r-- 1 conetto pawsey0912      274 Aug 30 15:53 chop-info.txt
-rw-r--r-- 1 conetto pawsey0912        0 Aug 30 15:53 chopped-unitig-unrolled-hifi-resolved.gfa
-rw-r--r-- 1 conetto pawsey0912  3815035 Aug 30 15:53 previous_paths
-rw-r--r-- 1 conetto pawsey0912       14 Aug 30 15:53 processONT.err
-rwxr-xr-x 1 conetto pawsey0912    11513 Aug 30 15:53 processONT.sh
-rw-r--r-- 1 conetto pawsey0912  2708104 Aug 30 15:53 selected-winnowmap.ids

Thanks.

Answer 3 · 2023-08-31T18:22:43.000Z

Thanks, given the empty gfa file, I'd guess the issue is in this step. Can you post the chop-info.txt file? What is the verkko version you're using?

Answer 4 · 2023-09-01T00:40:32.000Z

Hi @skoren,
Verkko version is 1.4.1, installed through conda and running in a HPC. The chop-info.txt file contains,

Traceback (most recent call last):
  File "/software/projects/pawsey0912/conetto/miniconda3/envs/verkko/lib/verkko/scripts/chop_misassemblies.py", line 63, in <module>
    if path[-1][0] == ">": end_node_offset = nodelens[end_node[1:]] - end_node_offset - 1
KeyError: 'uti'

Thanks again for your help.

Answer 5 · 2023-09-01T18:23:15.000Z

Can you share the 4-processONT and 2-processGraph folders? The canu FAQ has instructions on how to send the data:
https://canu.readthedocs.io/en/latest/faq.html

Answer 6 · 2023-09-02T01:37:50.000Z

Hi Sergey,
Having issues transferring the file after connecting to the ftp server, not sure if its a firewall issue with my institution. Anonymous login returns a

421 Service not available, remote server has closed connection.
ftp: Login failed

Any alternatives? Ive tared and compressed both folders.

Answer 7 · 2023-09-02T01:52:42.000Z

I saw a partially transferred file named caonetto.tar.gz. Once a file is written, if the connection is broken, it won't let you write it again/continue. I removed the file so you can try again. I don't have another great option for transferring large files, not sure if you have the ability to share it through something like google drive?

Answer 8 · 2023-09-02T02:48:27.000Z

Hi Koren,
Files has finished uploading. "caonetto.tar.gz"

Thank you.

Answer 9 · 2023-09-03T07:32:42.000Z

Hi Koren,

This does not seem to be an isolated error: I have the same content of "processONT.err". The "chopped-unitig-unrolled-hifi-resolved.gfa" file is empty too. Version 1.4, installed through conda. Content of chop-info.txt is:

Traceback (most recent call last):
File "/home/lakatos/asahm/miniconda3/envs/verkko/lib/verkko/scripts/chop_misassemblies.py", line 63, in
if path[-1][0] == ">": end_node_offset = nodelens[end_node[1:]] - end_node_offset - 1
KeyError: 'utig'

Best and thanks for your efforts,
Arne

Answer 10 · 2023-09-03T15:40:47.000Z

The alignment ONT file is corrupt and has invalid lines, which is the cause of the error. This should have caused the pipeline to stop if you have 1.4.1, 1.4 might have not caught it. Can you post the 3-alignTips/aligned*.sh and err files and check the err files for any error messages?

Answer 11 · 2023-09-03T19:00:37.000Z

Hi,

#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont001.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned001.WORKING.gaf

mv -f ../3-align/aligned001.WORKING.gaf ../3-alignTips/aligned001.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont002.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned002.WORKING.gaf

mv -f ../3-align/aligned002.WORKING.gaf ../3-alignTips/aligned002.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont003.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned003.WORKING.gaf

mv -f ../3-align/aligned003.WORKING.gaf ../3-alignTips/aligned003.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont004.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned004.WORKING.gaf

mv -f ../3-align/aligned004.WORKING.gaf ../3-alignTips/aligned004.gaf
#!/bin/sh
set -e


mv -f ../3-align/aligned005.WORKING.gaf ../3-alignTips/aligned005.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont006.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned006.WORKING.gaf

mv -f ../3-align/aligned006.WORKING.gaf ../3-alignTips/aligned006.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont007.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned007.WORKING.gaf

mv -f ../3-align/aligned007.WORKING.gaf ../3-alignTips/aligned007.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont008.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned008.WORKING.gaf

mv -f ../3-align/aligned008.WORKING.gaf ../3-alignTips/aligned008.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont009.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned009.WORKING.gaf

mv -f ../3-align/aligned009.WORKING.gaf ../3-alignTips/aligned009.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont010.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned010.WORKING.gaf

mv -f ../3-align/aligned010.WORKING.gaf ../3-alignTips/aligned010.gaf
#!/bin/sh
set -e


/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont011.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned011.WORKING.gaf

mv -f ../3-align/aligned011.WORKING.gaf ../3-alignTips/aligned011.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont012.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned012.WORKING.gaf

mv -f ../3-align/aligned012.WORKING.gaf ../3-alignTips/aligned012.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont013.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned013.WORKING.gaf

mv -f ../3-align/aligned013.WORKING.gaf ../3-alignTips/aligned013.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont014.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned014.WORKING.gaf

mv -f ../3-align/aligned014.WORKING.gaf ../3-alignTips/aligned014.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont015.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned015.WORKING.gaf

mv -f ../3-align/aligned015.WORKING.gaf ../3-alignTips/aligned015.gaf
#!/bin/sh
set -e

/home/lakatos/asahm/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont016.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned016.WORKING.gaf

mv -f ../3-align/aligned016.WORKING.gaf ../3-alignTips/aligned016.gaf

If I grep for "error" in the *.err files nothing comes back. There are, however, these warnings:

[WARNING] empty sequence name in the input.

Thanks again
Arne

Answer 12 · 2023-09-04T00:23:22.000Z

Updated results.

#!/bin/sh
set -e -o pipefail

/software/projects/pawsey0912/conetto/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont001.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned001.WORKING.gaf && mv -f ../3-align/aligned001.WORKING.gaf ../3-alignTips/aligned001.gaf
#!/bin/sh
set -e -o pipefail

/software/projects/pawsey0912/conetto/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont002.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned002.WORKING.gaf && mv -f ../3-align/aligned002.WORKING.gaf ../3-alignTips/aligned002.gaf
#!/bin/sh
set -e -o pipefail

/software/projects/pawsey0912/conetto/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont003.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned003.WORKING.gaf && mv -f ../3-align/aligned003.WORKING.gaf ../3-alignTips/aligned003.gaf
#!/bin/sh
set -e -o pipefail

/software/projects/pawsey0912/conetto/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont004.fasta.gz |sed s/de:f://g |awk -F "\t" '{ if ($12 >= 20 && $4-$3 > 5000 && 1-$21 >= 0.9) { if (match($5, "-")) print $1"\t"$2"\t"$3"\t"$4"\t+\t<"$6"\t"$7"\t"$7-$9"\t"$7-$8"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21; else print $1"\t"$2"\t"$3"\t"$4"\t"$5"\t>"$6"\t"$7"\t"$8"\t"$9"\t"$10"\t"$11"\t"$12"\t"$13"\t"$15"\tdv:f:"$21"\tid:f:"1-$21 }}' > ../3-align/aligned004.WORKING.gaf && mv -f ../3-align/aligned004.WORKING.gaf ../3-alignTips/aligned004.gaf

Updated for the error files

[M::mm_idx_gen::0.000*28.38] reading downweighted kmers
[M::mm_idx_gen::0.005*1.16] collected downweighted kmers, no. of kmers read=0
[M::mm_idx_gen::0.005*1.15] saved the kmers in a bloom filter: hash functions=2 and size=14384 
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[M::mm_idx_gen::3.126*1.13] collected minimizers
[M::mm_idx_gen::3.210*1.49] sorted minimizers
[M::main::3.211*1.49] loaded/built the index for 18059 target sequence(s)
[M::main::3.211*1.49] running winnowmap in SV-aware mode
[M::main::3.211*1.49] stage1-specific parameters minP:2000, incP:2.83, maxP:16000, sample:2000, min-qlen:10000, min-qcov:0.5, min-mapq:5, mid-occ:5000
[M::main::3.211*1.49] stage2-specific parameters s2_bw:2000, s2_zdropinv:25
[M::mm_idx_stat] kmer size: 15; skip: 50; is_hpc: 0; #seq: 18059
[M::mm_idx_stat::3.228*1.49] distinct minimizers: 568490 (33.05% are singletons); average occurrences: 7.612; average spacing: 36.191
[M::worker_pipeline::247.758*43.56] mapped 57659 sequences
[M::worker_pipeline::370.096*43.57] mapped 28254 sequences
[M::main] Version: 2.03, pthreads=24, omp_threads=3
[M::main] CMD: /software/projects/pawsey0912/conetto/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont001.fasta.gz
[M::main] Real time: 370.136 sec; CPU: 16125.572 sec; Peak RSS: 23.659 GB
[M::mm_idx_gen::0.000*39.13] reading downweighted kmers
[M::mm_idx_gen::0.005*1.12] collected downweighted kmers, no. of kmers read=0
[M::mm_idx_gen::0.005*1.12] saved the kmers in a bloom filter: hash functions=2 and size=14384 
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[M::mm_idx_gen::3.138*1.14] collected minimizers
[M::mm_idx_gen::3.210*1.45] sorted minimizers
[M::main::3.210*1.45] loaded/built the index for 18059 target sequence(s)
[M::main::3.210*1.45] running winnowmap in SV-aware mode
[M::main::3.210*1.45] stage1-specific parameters minP:2000, incP:2.83, maxP:16000, sample:2000, min-qlen:10000, min-qcov:0.5, min-mapq:5, mid-occ:5000
[M::main::3.210*1.45] stage2-specific parameters s2_bw:2000, s2_zdropinv:25
[M::mm_idx_stat] kmer size: 15; skip: 50; is_hpc: 0; #seq: 18059
[M::mm_idx_stat::3.225*1.45] distinct minimizers: 568490 (33.05% are singletons); average occurrences: 7.612; average spacing: 36.191
[M::worker_pipeline::244.537*43.72] mapped 58294 sequences
[M::worker_pipeline::368.348*43.95] mapped 29033 sequences
[M::main] Version: 2.03, pthreads=24, omp_threads=3
[M::main] CMD: /software/projects/pawsey0912/conetto/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont002.fasta.gz
[M::main] Real time: 368.383 sec; CPU: 16189.463 sec; Peak RSS: 22.119 GB
[M::mm_idx_gen::0.000*35.66] reading downweighted kmers
[M::mm_idx_gen::0.004*0.86] collected downweighted kmers, no. of kmers read=0
[M::mm_idx_gen::0.005*0.86] saved the kmers in a bloom filter: hash functions=2 and size=14384 
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[M::mm_idx_gen::3.705*1.12] collected minimizers
[M::mm_idx_gen::3.749*1.34] sorted minimizers
[M::main::3.749*1.34] loaded/built the index for 18059 target sequence(s)
[M::main::3.749*1.34] running winnowmap in SV-aware mode
[M::main::3.749*1.34] stage1-specific parameters minP:2000, incP:2.83, maxP:16000, sample:2000, min-qlen:10000, min-qcov:0.5, min-mapq:5, mid-occ:5000
[M::main::3.750*1.34] stage2-specific parameters s2_bw:2000, s2_zdropinv:25
[M::mm_idx_stat] kmer size: 15; skip: 50; is_hpc: 0; #seq: 18059
[M::mm_idx_stat::3.760*1.34] distinct minimizers: 568490 (33.05% are singletons); average occurrences: 7.612; average spacing: 36.191
[M::worker_pipeline::242.861*42.55] mapped 58173 sequences
[M::worker_pipeline::346.921*43.17] mapped 29265 sequences
[M::main] Version: 2.03, pthreads=24, omp_threads=3
[M::main] CMD: /software/projects/pawsey0912/conetto/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont003.fasta.gz
[M::main] Real time: 346.974 sec; CPU: 14977.815 sec; Peak RSS: 20.303 GB
[M::mm_idx_gen::0.000*38.19] reading downweighted kmers
[M::mm_idx_gen::0.004*1.10] collected downweighted kmers, no. of kmers read=0
[M::mm_idx_gen::0.004*1.10] saved the kmers in a bloom filter: hash functions=2 and size=14384 
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[WARNING]�[1;31m empty sequence name in the input.�[0m
[M::mm_idx_gen::3.133*1.14] collected minimizers
[M::mm_idx_gen::3.208*1.46] sorted minimizers
[M::main::3.208*1.46] loaded/built the index for 18059 target sequence(s)
[M::main::3.208*1.46] running winnowmap in SV-aware mode
[M::main::3.208*1.46] stage1-specific parameters minP:2000, incP:2.83, maxP:16000, sample:2000, min-qlen:10000, min-qcov:0.5, min-mapq:5, mid-occ:5000
[M::main::3.208*1.46] stage2-specific parameters s2_bw:2000, s2_zdropinv:25
[M::mm_idx_stat] kmer size: 15; skip: 50; is_hpc: 0; #seq: 18059
[M::mm_idx_stat::3.222*1.46] distinct minimizers: 568490 (33.05% are singletons); average occurrences: 7.612; average spacing: 36.191
[M::worker_pipeline::157.151*43.29] mapped 37114 sequences
[M::main] Version: 2.03, pthreads=24, omp_threads=3
[M::main] CMD: /software/projects/pawsey0912/conetto/miniconda3/envs/verkko/bin/winnowmap -t 24 -cx map-ont tips.fasta ../3-alignTips/split/ont004.fasta.gz
[M::main] Real time: 157.173 sec; CPU: 6803.091 sec; Peak RSS: 19.199 GB

Answer 13 · 2023-09-04T01:51:59.000Z

@asahm Your log looks like it's from v1.4 and I suspect one of the winnowmap jobs aborted early which wasn't properly caught. I expect updating to 1.4.1 would fix it, or at least, stop on the error. Can you check for an incomplete line in the gap outputs, it should have an entry with>utig (without any subsequent numbers) as the in the 6th column and post the full err file from whatever partition has a truncated/invalid output like that.

@caonetto I was referring to the output in 3-alignTips not 3-align, I wanted to confirm it looks like v1.4.1 and if there are any failures reported in the err files there. You could also upload the 3-alignTips folder to the FTP if that's easier and I can check it myself.

Answer 14 · 2023-09-04T01:59:52.000Z

Sorry for that @skoren , ive updated the response above. Lots of empty sequence error warnings.

Answer 15 · 2023-09-04T16:39:58.000Z

I wouldn't expect the warning to cause invalid output lines but perhaps it is. Either way, that warning is suspicious since there shouldn't be empty read lines in the input unless there is some issue with the input ONT file or with the splitting in verkko. Could you upload the 3-alignTips folder to the FTP, that will have info on the splitting and the ONT reads themselves.

Answer 16 · 2023-09-05T03:52:58.000Z

@skoren Ive uploaded the folder.

CHeers.

Answer 17 · 2023-09-05T14:52:31.000Z

OK so the issue isn't the alignment itself, it's the generation of the fasta sequence for the assembly to map to, specifically this line:

cat ../2-processGraph/unitig-unrolled-hifi-resolved.gfa |awk '{ if (match($1, "^S")) { print ">"$2; print $3 } }' |fold -b > tmp.fasta

I just ran it locally and it worked as expected but I checked your tips.fasta file and it's got strange line wrapping causing the problem which is also not consistent between contigs:

>utig1-180
53
TACATATCGCACTCGCACGATCTACTATCGTACTCACAGATCTAGCTCGTACTCGCTCAGACAGTGTAGTCTCAGAT
...
>utig1-18054
TCGTATCACGATACAGATGTAGATCGAGCGAGTACGACAG
TCGCGAGTATCGACAGTGATAGTGTGACTATGATGTAGATCGAGCGATACGATCGTATCTACGATACGATGTAGATCGTG

so for example it wrapped utig1-18053 but not utig1-18054. I'm guessing this is due to some differences in the fold utility on your system and ours. Can you run the above line and check for strange wrapping like the above example? Can you also check if adding -b -w 80 or just removing the -b fixes the fold command? Really fold is optional here, just for readability so I think the proper fix is to just remove it completely.

Answer 18 · 2023-09-05T17:47:20.000Z

I confirmed the fold utility is not needed and just committed a fix. You should be able to edit the relevant file in your conda install (e.g. something like /software/projects/pawsey0912/conetto/miniconda3/envs/verkko/lib/verkko/Snakefiles/3-alignTips.sm) to remove the |fold -b part of the command. You can then remove the 3-alignTips and 4-processONT folder and restart and it should run.

Answer 19 · 2023-09-06T01:56:46.000Z

Hi @skoren
That solved the problem when rerunning from mid-process however the assembly was incredibly small. I activated read correction (it was turned off for the original run for testing) and started a fresh run and now I am getting an error during the process-ONT stage, the processONT.err says

Solid ont coverage 43 and hifi 8
first unique coverage estimate: 9.464703057335086
Traceback (most recent call last):
  File "/software/projects/pawsey0912/conetto/miniconda3/envs/verkko/lib/verkko/scripts/estimate_unique_local.py", line 151, in <module>
    global_average_coverage = float(coverage_sum) / float(coverage_count)
ZeroDivisionError: float division by zero

Answer 20 · 2023-09-06T14:07:06.000Z

I suspect you would have gotten this with the previous run too, it just didn't get that far. That sounds like there are no large nodes to estimate coverage from or there are very few normally-covered long nodes. How much HiFi coverage are you assembling with and what kind of sample is this?

Answer 21 · 2023-09-08T00:40:26.000Z

Hi Koren,
I think youre right, theres probably not enough duplex reads to do the job when error correcting them. Its a plant genome which is quite complex in terms of repeats etc, and have only 10x haploid coverage. I think I am pushing it here. Thanks for your help koren and feel free to close this issue.

Cheers.

Answer 22 · 2023-09-08T21:20:18.000Z

If you can share the 1-buildGraph and the new 2-processGraph and 4-processONT folders, I should be able to take a look at exactly what the graph looks like before failure but, yes I expect it is a coverage issue.

Answer 23 · 2023-09-28T18:54:59.000Z

Idle, initial failure is addressed by removing fold utility from pipeline.