This repo was forked from the original RUCS repo (2023): https://bitbucket.org/genomicepidemiology/rucs
This tool was created as part of a research project.
For publication of results made using this tool, please cite: Martin Christen Frølund Thomsen, Henrik Hasman, Henrik Westh, Hülya Kaya, Ole Lund, RUCS: rapid identification of PCR primers for unique core sequences, Bioinformatics, Volume 33, Issue 24, December 2017, Pages 3917–3921, https://doi.org/10.1093/bioinformatics/btx526
A freely available online implementation of the original RUCS can be found here: https://cge.food.dtu.dk/services/RUCS/
There are two forms of qPCR: qPCR based on intercalating dyes, for example SYBR green; and hydrolysis probes such as TaqMan probes. The primary advantage of intercalating dyes is that they are cheaper than buying specific dye-tagged probes. However, dye binds non-specifically to doublestranded DNA, so the measured value can be misleading. For instance, dye may detect primer dimers or an unexpected amplification, rather than the target amplicons. Which brings us to the advantage of hydrolysis probes, they are specific to a target and only gives a signal when the polymerase is incorporating the probe into the amplicon. Additionally, the specificity of TaqMan probes also allows for multiplexing. Ie. having multiple probes with different dyes attached. This makes it possible to check for multiple specific targets of interest in the same PCR reaction.
RUCS supports both qPCR methods. For SYBR green, the standard options of RUCS will work. For TaqMan, the user has to specify the --pick_probe argument must be specified.
This repository contains the source code for a bioinformatics tool, which have several usage cases:
- Find sequences which are unique to a dataset of positive samples compared to a dataset of negative samples
- Identify PCR primer pairs for a given set of sequences
- Run PCR in silico, for a given set of primer pairs against a given set of references
- Annotate a given set of sequences for protein annotations from the NCBI refseq database
- Show PCR statistics for a given primer set to a given template
- Combine all of the above functionalities in a pipeline to provide a tool for rapid identification of PCR primer Pairs for the unique target sequences of a positive dataset versus a negative dataset
Authors: Martin Christen Frølund Thomsen
The entrypoints provide a quick interface to running the services in this software package.
To modify the settings and parameters for any entry point, modify or make a modified copy of settings.default.cjson.
If you want more flexibility, the primer_core_tools.py module can be imported into a python script, then you will have full access to all features. The classes and functions should be well documented in the source code.
This is the main method, which combines fucs and fppp into one serial execution.
Example of usage:
docker run --rm -v `pwd`:/workdir -v $BLASTDB:/blastdb \
rucs full -v --positives positives/* other/positive.fa --negatives negatives/*
Notice how you can specify multiple paths with or without wild cards as input. This is true for --positives and --negatives, and for vpcr's --references.
Note: To run the tool outside of docker, install the dependencies described in the Dockerfile on your local machine, and make a symbolic link to primer_core_tools.py in your /usr/local/bin called rucs. That way you can run the tool directly using the second line of the command above.
Note: You can specify which entries in the template you want analysed. Default for full is running against the first entry.
This method finds all the core sequences from the positive dataset, remove any sequence found in the negative dataset and returns two fasta files: contigs, containing the unique core sequences; dissected scaffolds, containing the fragments of the scaffolds which are usable for primer design.
Example of usage:
docker run --rm -v `pwd`:/workdir -v $BLASTDB:/blastdb \
rucs fucs --positives positives/* --negatives negatives/*
This method identifies primer pairs (and probe) using the Primer3 software. The found pairs are then additionally tested for PCR suitability. The eligible pairs are then clustered according to their position on the template and sorted in the clusters according to their PCR suitability. The best performing pairs are then BLASTed against the positive and negative datasets and sorted according to their sensitivity, specificity, uniqueness, noise, and PCR stats. The best candidate from each cluster gets their product annotated with gene annotations and the list of candidates with all relevant information is stored in a tab separated file.
Example of usage:
docker run --rm -v `pwd`:/workdir -v $BLASTDB:/blastdb \
rucs fppp --template template.fa --positives positives/* --negatives negatives/*
Simulate PCR in silico for a list of primer pairs against a list of references
Example of usage:
docker run --rm -v `pwd`:/workdir \
rucs vpcr --pairs pair_file.tsv --references references/*
Annotate provided sequence with BLAST protein annotations. A BLAST protein database must be installed. we recommend the swissprot database. It is reccommended to use the environment variable $BLASTDB to point to the BLAST repository, but a full path to the directory can also be provided.
Example of usage:
docker run --rm -v `pwd`:/workdir -v $BLASTDB:/blastdb \
rucs anno --template template.fa
This method will annotate a PCR primer set with PCR statistics, such as primer Tm, Hairpin Tm, primer-probe distance and much more.
Example of usage:
docker run --rm -v `pwd`:/workdir \
rucs pcrs --pairs pair_file.tsv --template template.fa
Explore the genomes of the positive dataset versus the negative dataset for Over- and underrepresentation of k-mers.
This method computes the over- and underrepresentation of k-mers in the positive genomes versus the negative genomes, and generates consensus sequences from these. It can be useful if you have two cluster of the same species that are pertain different effects and you aren't sure of why. In such a case, this method should provide you with results that can tell you what the differences are genetically.
Output The method creates two output files in fasta format. The first, containing the overrepresented sequences. The second, containing the underrepresented sequences. An overrepresented sequence is a sequence of DNA found significantly more often in the positive dataset compared to the negative dataset. An underrepresented sequence is a sequence of DNA found significantly more often in the negative dataset compared to the positive dataset. The fasta description header will contain the genome names where the given sequence is found.
Options There are four specific settings for this feature:
- kmer_count_threshold [default 1] - kmers found below this limit within each file are ignored
- sensitivity_threshold [default 0.6] - The sensitivity threshold defines how often a kmer must be found in the positive set to be included in the results. If provided as an integer the number is considered as a minimum count.
- fall_out_threshold [default 0.2] - The fall-out threshold defines how often k-mers may be found in the negative set and still be included in the results. If provided as an integer the number is considered as a maximum count.
- align_percent_threshold [default 0.05] - The alignment percent threshold defines the acceptable amount of kmers to not be aligned to a contig. These k-mers are lost from further analysis to speed up the process. Set to 0, if you want as much data as possible.
Example of usage
docker run --rm -v `pwd`:/workdir rucs expl -v --positives positives/* --negatives negatives/*
Fails? If you experience this method failing due to being killed, you can try increasing the allowed memory usage in the Docker setting. This method is quite memory intensive, a dataset of ~30 bacteria genomes can easily use more than 10GB RAM (peak).
Slow? This method is very cumbersome, which many heavy compute tasks, so the more references are used and the bigger the references, this can really take a long time to run. easpecially the step where the over- and underrepresented k-mers are converted into contigs and scaffolds sequences.
Other hidden features
The RUCS image comes with some hidden but convenient features/functionalities that can make your experience with the tool easier.
The RUCS image contains the Entrez Direct cmd-line tools and a small wrapper to make it easier for the user to download genomes when you know an accession ID like CP000672.1 or ARBW00000000.
To use the download script, the entrypoint must be changed, and a directory where the downloaded files should be stored must be mounted to the internal /workdir. And last but not least, the accession IDs must be provided as arguments.
The download script can be invoked like so:
docker run -it --entrypoint download_genomes.sh --rm -v `pwd`/positives:/workdir rucs CP063056 ARBW00000000 BBXJ00000000
docker run -it --entrypoint download_genomes.sh --rm -v `pwd`/negatives:/workdir rucs JWIZ01 JADGLC01 CP000672.1
Just switch out "pwd
/positives" with your preferred download directory, and
"CP000672.1 ARBW00000000", with your list of space-separated accessions.
** Fails? ** If the download script fails, it could be due to bad internet connection to NCBI. Try opening a browser and go to: https://eutils.ncbi.nlm.nih.gov/entrez/eutils/esearch.fcgi?db=assembly&term=JWIZ01 If this site is able to load, the download script should also work.
This is useful if a job has failed, or you just want to have a look at the already identified good primer pairs candidates.
- Open a python terminal within the RUCS container.
docker run -it --entrypoint python3 --rm -v `pwd`:/workdir rucs
- Extract the good primer pairs.
import sys
sys.path.append('/tools/')
from primer_core_tools import *
load_global_settings('settings.default.cjson')
work_dir, ref_dir, result_dir = setup_directories(get_ref_dir=True)
with open(f'{work_dir}good_primer_pairs.pkl', 'rb') as f:
reuse_i, too_short, skipped, ignored, no_pairs, good_pp = pickle.load(f)
- Show the primer pairs on screen (good for small files). Can be copy/pasted to an Excelsheet.
print(present_pairs_full(good_pp))
- Save the primer pairs as a tsv file (good for large files). Can be opened and viewed in Excel.
with open_('~/Downloads/good_primer_pairs.tsv', 'w') as f:
f.write(present_pairs_full(good_pp))
- Define positives and negative set (the same order as the original run)
positives = get_fasta_files(['inputs/positives/*'])
negatives = get_fasta_files(['inputs/negatives/*'])
- Extract PCR results.
refs = positives + negatives
lp = len(positives)
pcr_products = []
for p, pair in enumerate(good_pp):
pcr_products.append([[] for r in refs])
for r, ref in enumerate(positives):
pcr_products[p][r] = pair['products']['pos'][r]
for r, ref in enumerate(negatives):
pcr_products[p][lp+r] = pair['products']['neg'][r]
- Show PCR results on screen (good for small files). Can be copy/pasted to an Excelsheet.
print_pcr_Results(refs, pcr_products)
- Save the PCR results as a tsv file (good for large files). Can be opened and viewed in Excel.
print_pcr_Results(refs, pcr_products, '~/Downloads/products.tsv')
- Install and start docker
- Install the RUCS program
- Download BLAST annotation database
There are several ways to install the RUCS programs
https://hub.docker.com/repository/docker/mcft/rucs2
- Pull image
- Tag image
- Run test and see if everything is ok and ready to use
Commands for installation:
docker image pull mcft/rucs2
docker tag mcft/rucs2 rucs
docker run --rm -v `pwd`/test:/workdir -v $BLASTDB:/blastdb rucs test
docker image pull genomicepidemiology/rucs
docker tag genomicepidemiology/rucs rucs
docker run --rm -v `pwd`/test:/workdir -v $BLASTDB:/blastdb rucs test
- Clone this repository
- Build docker image
- Run test and see if everything is ok and ready to use
Commands for installation:
git clone https://github.com/martinfthomsen/rucs2
cd rucs2
docker-compose build
docker run --rm -v `pwd`/test:/workdir -v $BLASTDB:/blastdb rucs test
Not using docker? You can check out what to install and configure on your system from the Dockerfile. After everything is installed and ready, Verify that all dependencies are in your local PATH and the Python modules are properly installed:
which python3 samtools bwa blastn blastx makeblastdb
python3 -c 'import gzip, json, types, shutil, glob, bisect, primer3, numpy, subprocess, difflib, tabulate'
A BLAST protein database must be installed separately if you want RUCS to annotate the results with protein annotations. we recommend installing the swissprot database. It is recommended to use the environment variable $BLASTDB to point to the BLAST database.
BLASTDB=/blastdb
mkdir $BLASTDB
docker run --rm --entrypoint update_blastdb.pl -v $BLASTDB:/workdir rucs --decompress swissprot
If you are using the the $BLASTDB environment variable, it is recommended to set it in your bash_profile file:
echo "BLASTDB=$BLASTDB" >> ~/.bash_profile
Alternatively, it is possible to run the local script to this repo (install_db.sh), to download multiple databases in parallel:
./install_db.sh $BLASTDB swissprot
The alternative script also downloads the file all_blast_db_files.txt, which lists all available blast databases. and a ...-metadata.json file with details of the database
You can also choose to download other databases such as refseq_protein. Downloading the refseq_protein database can take a while, since the database is > 20 GB...
OBS: If you don't need the annotation capabilities, you can opt out of this!
To see the help page, run the following command:
docker run --rm rucs --help
This example below assumes that the $BLASTDB environment variable is set.
Command:
docker run --rm -v `pwd`/test:/workdir -v $BLASTDB:/blastdb rucs full --positives CP000672.1 ARBW00000000 --negatives JWIZ01
RUCS will create the run directory "test" in your current directory, download the fasta files for the two provided accession IDs in the positives argument, and the single accession ID in the negatives argument. RUCS will then run the full analysis algorithm to identify the good PCR primer pairs that only produces amplicons for the samples in the positives argument.
As the -v option is provided to RUCS, the screen should display the following progress log information:
processing CP000672.1...
found GCA_000016485.1_ASM1648v1_genomic.fna.gz! Downloading...
processing ARBW00000000...
found GCA_000379905.1_ASM37990v1_genomic.fna.gz! Downloading...
processing JWIZ01...
found GCA_001038205.1_ASM103820v1_genomic.fna.gz! Downloading...
# Running RUCS...
# Prepare reference: CP000672.1_GCA_000016485.1_ASM1648v1_genomic.fna.gz...
# Prepare inputs: 2 positive and 1 negative genomes...
# Finding unique core sequences...
# Computing k-mer intersection...
# Extracting k-mers from CP000672.1_GCA_000016485.1_ASM1648v1_genomic.fna.gz...
# Extracting k-mers from ARBW00000000_GCA_000379905.1_ASM37990v1_genomic.fna.gz...
# Aligning core_kmers.fq to reference.fa...
# Computing k-mer contigs and scaffolds...
# Computing k-mer complement to the negative genomes...
# Extracting k-mers from JWIZ01_GCA_001038205.1_ASM103820v1_genomic.fna.gz...
# Filtering the negative k-mers found in {os.path.basename(genome)}...
# Computing k-mer contigs and scaffolds...
# Find valid primer pairs for PCR...
# Scanning contig 0_1375921_0 for primer pairs...
# Aligning primers to positive references...
# Aligning primers.fa to CP000672.1_GCA_000016485.1_ASM1648v1_genomic.fna.gz...
# Aligning primers.fa to ARBW00000000_GCA_000379905.1_ASM37990v1_genomic.fna.gz...
# Aligning primers to negative references...
# Aligning primers.fa to JWIZ01_GCA_001038205.1_ASM103820v1_genomic.fna.gz...
# Ranking primer pairs...
# Sorting primer pairs...
# Validating primer pairs...
# Current good pp: 71...
# Annotating PCR product environment...
372 sequence were ignored since they were not in the sequence selection!
Your new run directory should now hold the following files:
ARBW00000000_GCA_000379905.1_ASM37990v1_genomic.fna.gz
CP000672.1_GCA_000016485.1_ASM1648v1_genomic.fna.gz
JWIZ01_GCA_001038205.1_ASM103820v1_genomic.fna.gz
core_sequences.aux.tsv
core_sequences.contigs.fa
core_sequences.disscafs.fa
core_sequences.scaffolds.fa
pairs.json
pcr_products_with_skirts.blastx.err
pcr_products_with_skirts.blastx.tsv
pcr_products_with_skirts.fa
primers.fa
products.tsv
results.tsv
results_best.tsv
stats.log
unique_core_sequences.aux.tsv
unique_core_sequences.contigs.fa
unique_core_sequences.disscafs.fa
unique_core_sequences.scaffolds.fa
You will find a list of the best candidates in the "results_best.tsv" file.
This example assumes the same setup steps as the example of the full run (step 1-3) has been performed.
Steps:
- Run the docker image in interactive mode
- Run the full analysis command directly on the main script
- Inspect the results, etc.
docker run -it --entrypoint /bin/bash --rm -v `pwd`:/workdir -v $BLASTDB:/blastdb rucs
primer_core_tools.py full --positives positives/* other/positive.fa --negatives negatives/*
In the interactive mode, you are inside the RUCS container, and you will only be able to interact with the container and the material you bring with you through mounting, like the workdir and blastdb in the command above. You can run any command available in there and manipulate what ever files you wish. OBS! Only changes made in the mounted directories are kept after you exit the container.
You can also run python inside the container and import the primer core tools from RUCS.
The following command will open an interactive terminal inside the RUCS container.
docker run -it --entrypoint python3 --rm -v `pwd`:/workdir -v $BLASTDB:/blastdb rucs
The following commands will run the full RUCS algorithm using the files in the positives directory as the positives references, and vice-versa for the negatives references.
>>> import sys
>>> sys.path.append('/tools/')
>>> from primer_core_tools import *
>>> load_global_settings('settings.default.cjson')
>>> positives = [x for x in glob.glob("positives/*") if check_file_type(x) == 'fasta']
>>> negatives = [x for x in glob.glob("negatives/*") if check_file_type(x) == 'fasta']
>>> reference = positives[0]
>>> main(positives, negatives, reference, quiet=False, clean_run=True, annotate=True)
...
To check which files are available to you in your directories you can run the following command.
This example finds all files ending with ".fa" in your current working directory
>>> find_files('*.fa')
['core_sequences.contigs.fa', 'core_sequences.disscafs.fa', ...]
Sometimes when working with RUCS, it is nice to be able to interact with the sequence data from the involved fasta files.
Below is an example of how to parse a fasta file and store the sequences in a list
>>> my_seqs = [seq for seq, name, desc in seqs_from_file('bla.fa')]
>>> my_seqs[0]
'ATGCGACCATTTTT...'
The primary results from RUCS are stored in the results_best.tsv file. These are the good primer pair candidates identified to spefically produce amplicons for the positives references. The results are stored as a TSV file which can be loadet and processed in the terminal.
Below is an example of how to load the identified primer pairs and statistics from results_best.tsv and extract useful information.
>>> results = parse_tsv('results_best.tsv')
>>> results[0]['sequence_id']
'0_1375921_0'
>>> results[0]['forward_primer']
'CACCCAGTAGAGCACACTTTG'
>>> results[0]['forward_position']
'2525'
In the results_best.tsv file you will find the primer/probe positions, but as the positions here refer to the position in the dissected scaffold of the unique core sequence, it rarely translates into the position in the reference sequence. However, the results also provides the sequence id from the dissected scaffolds, which provides the necessary information to compute the primer/probe position relative to the reference sequence.
The first number of the sequence id refer to the index of the sequence in the reference. The second number of the sequence id refer to the position of the dissected scaffold in the reference sequence.
Below is an example of how to use the sequence id and the forward_position to extract the forward_primer sequence from the reference sequence.
>>> sequence_id = "0_1375921_0"
>>> forward_primer = "CACCCAGTAGAGCACACTTTG"
>>> forward_position = "2525"
>>> sid = int(sequence_id.split('_')[0])
>>> spos = int(sequence_id.split('_')[1])
>>> ppos = int(forward_position)
>>> length = len(forward_primer)
>>> my_seqs[sid][spos+ppos:spos+ppos+length] == forward_primer
True
The full run creates 8 note worthy files. stats.log This file gives an overview and statistics on the progress.
The fucs part of the algorithm produces 3 important result files:
- core_sequences.contigs.fa This file contain the core sequences, the sequences which are common to all the positive references .
- unique_core_sequences.contigs.fa This file contain the unique core sequences, the sequences which are common to all the positive references and not found in any of the negative references.
- unique_core_sequences.disscafs.fa This file contain the dissected scaffolds for the unique core sequences.
contigs contains the clean sequences annotated with position in the reference.
disscafs contains the dissected scaffolds, where the sequences which are close in proximity have been joined with stretches of n's to fill out the gaps between the sequences. This makes it possible to identify primer pairs which are uniquely binding but where the amplicon contains non-unique stretches of DNA.
The fppp part of the algorithm creates 3 important files:
- results_best.tsv This file shows the best matches for primer pair candidates.
- results.tsv This file provides an exaustive list of all the tested primer pair candidates.
- products.tsv This file provides the results of the virtual PCR for all tested primer pair candidates.
See first part of the full run
See last part of the full run
This entry point provides one important file products.tsv This file shows the vpcr results for all the tested pairs
This entry point provides no result files, but instead shows the annotations found directly on the screen in a json format. EG.
{"0": [1, 735, ["DIM/GIM/SIM family subclass B1 metallo-beta-lactamase"]]}
The key '0' is the contig name where the annotaion was discovered.
The value is a list of hits found on different places in the contig.
The first item in a hit 1 is the starting position of the hit.
The second item in a hit 735 is the end position of the hit.
The third item in a hit ['DIM/GIM/SIM family subclass B1 metallo-beta-lactamase'] is a reduced list of BLAST annotations matching the given hit.
This entry point provides no result files, but instead shows the the statistics for the provided pairs directly on the screen.
The Explore entrypoint is similar to the fucs entry point. But where fucs method is focussed on identifying unique core sequences, the Explore method tries to find over-represented (ors) and under-represented sequences (urs):
- ors.contigs.fa This file contain the contigs of the over-represented sequences.
- ors.disscafs.fa This file contain the dissected scaffolds of the over-represented sequences.
- urs.contigs.fa This file contain the contigs of the under-represented sequences.
- urs.disscafs.fa This file contain the dissected scaffolds of the under-represented sequences.
ORS can be used to identify primer pairs to target most of the positive references, and URS can be used to identify primer pairs to target most of the negative references.
For instance, sometimes what strains have in common might not be what DNA they share, but ratcher what they are missing. The URS will provide this insight of any missing DNA. The explore method stops at this stage. To get primer pair identification, Virtual PCR, etc. please run the FPPP method using either the ors.disscafs.fa or urs.disscafs.fa as the template option.
This is probably caused by lack of RAM. For MACs and Windows, a virtual machine is used to run a Linux environment where Docker can run. This machine has a limit on how much of the host's RAM it may access. Check if you have enough RAM allocated, or try to increase the amount of RAM for your machine. Otherwise, consider using a smaller BLAST database.
# Stop and remove all containers (instances of images)
docker rm $(docker stop $(docker ps -aq))
# Remove all exited containers
docker rm -v $(docker ps -aq -f status=exited)
# Remove all dangling images
docker rmi $(docker images -qf "dangling=true")
# Remove all dangling volumes
docker volume rm $(docker volume ls -qf dangling=true)
You can report your issues here: https://github.com/martinfthomsen/rucs2/issues
RUCS 2: https://github.com/martinfthomsen/rucs2
Copyright ©️ 2023, Martin Christen Frølund Thomsen.
Original RUCS: https://bitbucket.org/genomicepidemiology/rucs
Copyright ©️ 2017, Martin Christen Frølund Thomsen, Technical University of Denmark.
All rights reserved.
Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and limitations under the License.