https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-022-04673-3
Software implementation of KnotAli.
KnotAli is an algorithm for predicting the pseudoknotted secondary structures of RNA using relaxed Hierarchical Folding.
Linux, macOS
Requirements: A compiler that supports C++20 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.8 or greater.
CMake version 3.8 or greater must be installed in a way that KnotAli can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:
cmake --version
If it does not print a cmake version greater than or equal to 3.8, you will have to install CMake depending on your operating system.
For issues with OpenSSL, installing libssl-dev can fix it, e.g. In Ubuntu, sudo apt-get install libssl-dev
- Download the repository and extract the files onto your system.
- From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build
If you need to specify a specific compiler, such as g++, you can instead run something like
cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build
This can be useful if you are getting errors about your compiler not having C++11 features.
After installing you can move the executables wherever you wish, but you should not delete or move the simfold folder, or you must recompile the executables. If you move the folders and wish to recompile, you should first delete the created "build" folder before recompiling.
Usage: KnotAli[options] [input file]
Read input file from cmdline; predict minimum free energy and optimum structure using the time- and space-efficient MFE RNA folding algorithm for each sequence in the alignment.
-h, --help Print help and exit
-V, --version Print version and exit
-v, --verbose Turn on verbose
-i, --input-type Specify input file type (CLUSTAL, FASTA, or Stockholm, base is FASTA)
-o, --output-file Specify output file
-p, --pseudoknot Turns off pseudoknot prediction
assume you are in the KnotAli directory
./build/src/KnotAli myinputfile.txt
./build/src/KnotAli -o outputfile.txt myinputfile.afa
Let's go through an example from the example folder: align_ex1.fa. The first three sequences from this file are:
>tRNA_tdbR00000184-Asterias_amurensis-7602-Lys-CUU
--CUUUGAUAAGCUUAUAAUGGCA-AGCAUUAAACUCUUAAUUUAAAUCAAAGUGAUCUCACCACACUAUCAAAGACCA
>tRNA_tdbR00000189-Rattus_norvegicus-10116-Lys-NUU
------CAUUGCGAAGC----UUAGAGCGUUAACCUUUUAAGUUAAAGUUAGAGACAACAAAUCUCCACAAUG--ACCA
>tRNA_tdbR00000190-Bos_taurus-9913-Lys-NUU
-CACUAAGAAGC--------UAUAUAGCACUAACCUUUUAAGUUAGAGAUUGAGAGCCAUAUACUCUCCUUGGUGACCA
_(((((((___((____________))__(((((_x_____)))))_____((((_________)))))))))))_xxx (consensus structure)
The consensus structure shown above is the result of the covariation portion of the algorithm. The '_' represents nucleotides that are allowed to pair
in the final step. In contrast 'x' represents nucleotides which the covariation deemed unlikely to pair and thus are restricted from pairing.
Each '(' and ')' an opening and closing base pair within the structure. The consensus can be seen when using the -v (verbose) command.
After running KnotAli, you will have your output file (in the case of our example: align_sol1.txt) in the format of
line 1: Sequence name
line 2: Sequence
line 3: Output Structure
line 4: Output Energy
We give the first three sequences from prior in this format after running:
>tRNA_tdbR00000184-Asterias_amurensis-7602-Lys-CUU
CUUUGAUAAGCUUAUAAUGGCAAGCAUUAAACUCUUAAUUUAAAUCAAAGUGAUCUCACCACACUAUCAAAGACCA
.((.(....[[[......]]].....(((((.......))))).....((((.........)))).).))......
0.53
>tRNA_tdbR00000189-Rattus_norvegicus-10116-Lys-NUU
CAUUGCGAAGCUUAGAGCGUUAACCUUUUAAGUUAAAGUUAGAGACAACAAAUCUCCACAAUGACCA
[[[[[.[..[[[...]]]........(((((.......))))).............].]]]]]....
-2.38
>tRNA_tdbR00000190-Bos_taurus-9913-Lys-NUU
CACUAAGAAGCUAUAUAGCACUAACCUUUUAAGUUAGAGAUUGAGAGCCAUAUACUCUCCUUGGUGACCA
(((((((..[([....])].(((((.......))))).....(((([.......])))))))))))....
-11.61
For each sequence, KnotAli gives the minimum free energy and structure given the restricted structure found in the covariation step.
The three examples were aligned using the MUSCLE software (doi:10.1186/1471-2105-5-113). The first example: align_ex1.fa was compiled of 100 tRNA sequences
in FASTA format. The results of running KnotAli on this example can also be found in align_sol1.txt.
align_ex2.fa, also in FASTA format, is comprised of 100 RNaseP sequences and its structures are found in align_sol2.txt.
align_ex3.aln is an example file in CLUSTAL format. It was comprised of 100 SRP sequences, and its structure can found in align_sol3.txt
Lastly, align_ex4.stockholm is an example file in stockholm format. It was comprised of 954 tRNA, and its structur can be found in align_sol4.txt. Align_sol4.txt was ran with -p input parameter which turns off pseudoknot prediction.
Robert C. Edgar. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinformatics, 5:113, Aug 2004