read_fasta error
Closed this issue · 8 comments
GoogleCodeExporter commented
What steps will reproduce the problem?
1. read_fasta
2.
3.
What is the expected output? What do you see instead?
normal behavior. But it throws error like this
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/biopieces.rb:629:in
`open'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/biopieces.rb:629:in `log'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/biopieces.rb:680:in `block in <top (required)>'
/usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require': cannot load
such file -- narray (LoadError)
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/bits.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/seq.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/fasta.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/bp_bin/read_fasta:32:in `<main>'
What version of the product are you using? On what operating system?
0.48
ubuntu 12.04
Please provide any additional information below.
perl 5
ruby 1.9.3p0 (2011-10-30 revision 33570) [x86_64-linux]
Original issue reported on code.google.com by rajk...@miamioh.edu on 25 Apr 2013 at 3:11
GoogleCodeExporter commented
You need to install narray. Run bp_test.
Original comment by martinah...@gmail.com on 26 Apr 2013 at 7:09
- Changed state: WontFix
GoogleCodeExporter commented
I successively installed narray but I still get error messages. Below I paste
the messages,
sudo gem install narray
Invalid gemspec in [/var/lib/gems/1.8/specifications/ZenTest-4.9.1.gemspec]: Illformed requirement ["< 2.1, >= 1.8"]
Invalid gemspec in [/var/lib/gems/1.8/specifications/ZenTest-4.9.1.gemspec]: Illformed requirement ["< 2.1, >= 1.8"]
Building native extensions. This could take a while...
Invalid gemspec in [/var/lib/gems/1.8/specifications/ZenTest-4.9.1.gemspec]: Illformed requirement ["< 2.1, >= 1.8"]
Successfully installed narray-0.6.0.8
1 gem installed
Invalid gemspec in [/var/lib/gems/1.8/specifications/ZenTest-4.9.1.gemspec]: Illformed requirement ["< 2.1, >= 1.8"]
Installing ri documentation for narray-0.6.0.8...
Installing RDoc documentation for narray-0.6.0.8...
After narray installation I tried read_fasta I get the following,
/home/rajkump/Software/biopieces/code_ruby/lib/maasha/biopieces.rb:629:in
`initialize': Permission denied - /home/rajkump/Software/BP_LOG/biopieces.log
(Errno::EACCES)
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/biopieces.rb:629:in `open'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/biopieces.rb:629:in `log'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/biopieces.rb:680:in `block in <top (required)>'
/usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require': cannot load
such file -- narray (LoadError)
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/bits.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/seq.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/fasta.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/bp_bin/read_fasta:32:in `<main>'
Original comment by rajk...@miamioh.edu on 26 Apr 2013 at 8:57
GoogleCodeExporter commented
It's not a bug - you need to create the /home/rajkump/Software/BP_LOG/
directory and make sure permissions are 755.
Join the Google Group for support: http://groups.google.com/group/biopieces
Original comment by martinah...@gmail.com on 27 Apr 2013 at 11:15
GoogleCodeExporter commented
Thanks for the reply. But I still have problem. I solved the permission issues
now I get something like this,
rajkump@bioinfo-GPU:~/Software/biopieces/bp_test$ read_fasta
/usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require': cannot load
such file -- narray (LoadError)
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/bits.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/seq.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/fasta.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/bp_bin/read_fasta:32:in `<main>'
Yes I do have narray
rajkump@bioinfo-GPU:~/Software/biopieces/bp_test$ gem list | grep array
Invalid gemspec in [/var/lib/gems/1.8/specifications/ZenTest-4.9.1.gemspec]:
Illformed requirement ["< 2.1, >= 1.8"]
Invalid gemspec in [/var/lib/gems/1.8/specifications/ZenTest-4.9.1.gemspec]:
Illformed requirement ["< 2.1, >= 1.8"]
narray (0.6.0.8)
rajkump@bioinfo-GPU:~/Software/biopieces/bp_test$
I did bp-test and the result is not good
I paste the Fail commands
Testing analyze_assembly -I $BP_DIR/bp_test/in/analyze_assembly.in -O
$BP_TMP/rajkump.analyze_assembly.out ... FAIL
Testing analyze_assembly -I $BP_DIR/bp_test/in/analyze_assembly.in -o
$BP_TMP/rajkump.analyze_assembly.out -x ... FAIL
Testing analyze_seq -I $BP_DIR/bp_test/in/analyze_seq.in -O
$BP_TMP/rajkump.analyze_seq.out ... FAIL
Testing assemble_pairs -I $BP_DIR/bp_test/in/assemble_pairs.in -O
$BP_TMP/rajkump.assemble_pairs.out ... FAIL
Testing assemble_pairs -o 70 -I $BP_DIR/bp_test/in/assemble_pairs.in -O
$BP_TMP/rajkump.assemble_pairs.out ... FAIL
Testing blast_seq -I $BP_DIR/bp_test/in/blast_seq.in.2 -d
$BP_TMP/rajkump.test_tmp/protein -O $BP_TMP/rajkump.blast_seq.out ... FAIL
Testing blast_seq -I $BP_DIR/bp_test/in/blast_seq.in.4 -d
$BP_TMP/rajkump.test_tmp/nucleotide -O $BP_TMP/rajkump.blast_seq.out ... FAIL
Testing blast_seq -I $BP_DIR/bp_test/in/blast_seq.in.4 -d
$BP_TMP/rajkump.test_tmp/protein -O $BP_TMP/rajkump.blast_seq.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.1 -O
$BP_TMP/rajkump.blast_seq_pair.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.2 -O
$BP_TMP/rajkump.blast_seq_pair.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.3 -O
$BP_TMP/rajkump.blast_seq_pair.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.4 -O
$BP_TMP/rajkump.blast_seq_pair.out ... FAIL
Testing blast_seq_pair -I $BP_DIR/bp_test/in/blast_seq_pair.in.1 -p tblastx -O
$BP_TMP/rajkump.blast_seq_pair.out ... FAIL
Testing clip_adaptor -I $BP_DIR/bp_test/in/clip_adaptor.in -O
$BP_TMP/rajkump.clip_adaptor.out ... FAIL
Testing digest_seq -p GGATCC -c 1 -I $BP_DIR/bp_test/in/digest_seq.in -O
$BP_TMP/rajkump.digest_seq.out ... FAIL
Testing digest_seq -p GGACTT -c 1 -I $BP_DIR/bp_test/in/digest_seq.in -O
$BP_TMP/rajkump.digest_seq.out ... FAIL
Testing digest_seq -p GGATCC -c 1000 -I $BP_DIR/bp_test/in/digest_seq.in -O
$BP_TMP/rajkump.digest_seq.out ... FAIL
Testing digest_seq -p GGATCC -c -1000 -I $BP_DIR/bp_test/in/digest_seq.in -O
$BP_TMP/rajkump.digest_seq.out ... FAIL
Testing find_adaptor -m 0 -i 0 -d 0 -f TCGTATGCCGTCTTCTGCTT -I
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 0 -i 0 -d 0 -F TCGTATGCCGTCTTCTGCTT -I
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 0 -i 0 -d 0 -r TGACTACGACTACGACTACT -I
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 0 -i 0 -d 0 -R TGACTACGACTACGACTACT -I
$BP_DIR/bp_test/in/find_adaptor.in -O $BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 0 -i 0 -d 0 -f TCGTATGCCGTCTTCTGCTT -r
TGACTACGACTACGACTACT -I $BP_DIR/bp_test/in/find_adaptor.in -O
$BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 0 -i 0 -d 0 -f TCGTATGCCGTCTTCTGCTT -l 1 -r
TGACTACGACTACGACTACT -I $BP_DIR/bp_test/in/find_adaptor.in -O
$BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 0 -i 0 -d 0 -f TCGTATGCCGTCTTCTGCTT -l 1 -r
TGACTACGACTACGACTACT -L 1 -I $BP_DIR/bp_test/in/find_adaptor.in -O
$BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 10 -i 0 -d 0 -f TCGTATGCCGTCTTCTGCTT -r
TGACTACGACTACGACTACT -I $BP_DIR/bp_test/in/find_adaptor.in -O
$BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 0 -i 10 -d 0 -f TCGTATGCCGTCTTCTGCTT -r
TGACTACGACTACGACTACT -I $BP_DIR/bp_test/in/find_adaptor.in -O
$BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_adaptor -m 0 -i 0 -d 10 -f TCGTATGCCGTCTTCTGCTT -r
TGACTACGACTACGACTACT -I $BP_DIR/bp_test/in/find_adaptor.in -O
$BP_TMP/rajkump.find_adaptor.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -r -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -rg -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -rgb
/home/rajkump/Software/biopieces/bp_test/in/find_barcodes.in.2 -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -r -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -rg -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -rgb
/home/rajkump/Software/biopieces/bp_test/in/find_barcodes.in.2 -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -m 1 -r -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -m 1 -rg -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -m 1 -rgb
/home/rajkump/Software/biopieces/bp_test/in/find_barcodes.in.2 -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -m 2 -r -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -m 2 -rg -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -m 2 -rgb
/home/rajkump/Software/biopieces/bp_test/in/find_barcodes.in.2 -O
$BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_barcodes -I $BP_DIR/bp_test/in/find_barcodes.in.1 -p 4 -m 2 -Rrg
-O $BP_TMP/rajkump.find_barcodes.out ... FAIL
Testing find_homopolymers -I $BP_DIR/bp_test/in/find_homopolymers.in -O
$BP_TMP/rajkump.find_homopolymers.out ... FAIL
Testing find_homopolymers -I $BP_DIR/bp_test/in/find_homopolymers.in -m 3 -O
$BP_TMP/rajkump.find_homopolymers.out ... FAIL
Testing join_seq -I $BP_DIR/bp_test/in/join_seq.in -O
$BP_TMP/rajkump.join_seq.out ... FAIL
Testing join_seq -I $BP_DIR/bp_test/in/join_seq.in -d 'X' -O
$BP_TMP/rajkump.join_seq.out ... FAIL
Testing kmer_freq -I $BP_DIR/bp_test/in/kmer_freq.in -O
$BP_TMP/rajkump.kmer_freq.out ... FAIL
Testing mask_seq -I $BP_DIR/bp_test/in/mask_seq.in -O
$BP_TMP/rajkump.mask_seq.out ... FAIL
Testing mask_seq -I $BP_DIR/bp_test/in/mask_seq.in -c 0 -O
$BP_TMP/rajkump.mask_seq.out ... FAIL
Testing mask_seq -I $BP_DIR/bp_test/in/mask_seq.in -h -O
$BP_TMP/rajkump.mask_seq.out ... FAIL
Testing mean_scores -I $BP_DIR/bp_test/in/mean_scores.in -O
$BP_TMP/rajkump.mean_scores.out ... FAIL
Testing mean_scores -I $BP_DIR/bp_test/in/mean_scores.in -l -O
$BP_TMP/rajkump.mean_scores.out ... FAIL
Testing mean_scores -I $BP_DIR/bp_test/in/mean_scores.in -l -w 10 -O
$BP_TMP/rajkump.mean_scores.out ... FAIL
Testing merge_pair_seq -I $BP_DIR/bp_test/in/merge_pair_seq.in -O
$BP_TMP/rajkump.merge_pair_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.1 -p GACT -O
$BP_TMP/rajkump.patscan_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.1 -p GACT -c -O
$BP_TMP/rajkump.patscan_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.1 -p GACT -i -O
$BP_TMP/rajkump.patscan_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.2 -p RARP -O
$BP_TMP/rajkump.patscan_seq.out ... FAIL
Testing patscan_seq -I $BP_DIR/bp_test/in/patscan_seq.in.2 -p RARP -i -O
$BP_TMP/rajkump.patscan_seq.out ... FAIL
Testing pcr_seq -f CGATCGAGCT -r AGTCAGTCAT -I $BP_DIR/bp_test/in/pcr_seq.in -O
$BP_TMP/rajkump.pcr_seq.out ... FAIL
Testing pcr_seq -f CGATCGAGCT -r AGTCAGTCAT -m 1 -I
$BP_DIR/bp_test/in/pcr_seq.in -O $BP_TMP/rajkump.pcr_seq.out ... FAIL
Testing pcr_seq -F CGATCGAGCT -r AGTCAGTCAT -I $BP_DIR/bp_test/in/pcr_seq.in -O
$BP_TMP/rajkump.pcr_seq.out ... FAIL
Testing pcr_seq -f CGATCGAGCT -R AGTCAGTCAT -I $BP_DIR/bp_test/in/pcr_seq.in -O
$BP_TMP/rajkump.pcr_seq.out ... FAIL
Testing pcr_seq -F CGATCGAGCT -R AGTCAGTCAT -I $BP_DIR/bp_test/in/pcr_seq.in -O
$BP_TMP/rajkump.pcr_seq.out ... FAIL
Testing plot_distribution -k SEQ_LEN -I $BP_DIR/bp_test/in/plot_distribution.in
-o $BP_TMP/rajkump.plot_distribution.out -x ... FAIL
Testing read_embl -i $BP_DIR/bp_test/in/read_embl.in -O
$BP_TMP/rajkump.read_embl.out ... FAIL
Testing read_embl -i $BP_DIR/bp_test/in/read_embl.in.gz -O
$BP_TMP/rajkump.read_embl.out ... FAIL
Testing read_embl -i $BP_DIR/bp_test/in/read_embl.in -k AC -O
$BP_TMP/rajkump.read_embl.out ... FAIL
Testing read_embl -i $BP_DIR/bp_test/in/read_embl.in -k AC -f CDS -O
$BP_TMP/rajkump.read_embl.out ... FAIL
Testing read_embl -i $BP_DIR/bp_test/in/read_embl.in -k AC -f CDS -q
translation -O $BP_TMP/rajkump.read_embl.out ... FAIL
Testing read_fasta -i $BP_DIR/bp_test/in/read_fasta.in -O
$BP_TMP/rajkump.read_fasta.out ... FAIL
Testing read_fasta -i $BP_DIR/bp_test/in/read_fasta.in.gz -O
$BP_TMP/rajkump.read_fasta.out ... FAIL
Testing read_fasta -i $BP_DIR/bp_test/in/read_fasta.in -n 1 -O
$BP_TMP/rajkump.read_fasta.out ... FAIL
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in.1 -O
$BP_TMP/rajkump.read_fastq.out ... FAIL
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in.1 -e base_33 -O
$BP_TMP/rajkump.read_fastq.out ... FAIL
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in.2 -O
$BP_TMP/rajkump.read_fastq.out ... FAIL
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in.2 -e base_64 -O
$BP_TMP/rajkump.read_fastq.out ... FAIL
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in.1.gz -O
$BP_TMP/rajkump.read_fastq.out ... FAIL
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in.1 -n 1 -O
$BP_TMP/rajkump.read_fastq.out ... FAIL
Testing read_fastq -i $BP_DIR/bp_test/in/read_fastq.in.3 -j
/home/rajkump/Software/biopieces/bp_test/in/read_fastq.in.4 -O
$BP_TMP/rajkump.read_fastq.out ... FAIL
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in -O
$BP_TMP/rajkump.read_genbank.out ... FAIL
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in.gz -O
$BP_TMP/rajkump.read_genbank.out ... FAIL
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in -k AC -O
$BP_TMP/rajkump.read_genbank.out ... FAIL
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in -k AC -f CDS -O
$BP_TMP/rajkump.read_genbank.out ... FAIL
Testing read_genbank -i $BP_DIR/bp_test/in/read_genbank.in -k AC -f CDS -q
translation -O $BP_TMP/rajkump.read_genbank.out ... FAIL
Testing read_sff -i $BP_DIR/bp_test/in/read_sff.in -O
$BP_TMP/rajkump.read_sff.out ... FAIL
Testing read_sff -i $BP_DIR/bp_test/in/read_sff.in -n 1 -O
$BP_TMP/rajkump.read_sff.out ... FAIL
Testing read_sff -i $BP_DIR/bp_test/in/read_sff.in -n 1 -m -O
$BP_TMP/rajkump.read_sff.out ... FAIL
Testing read_sff -i $BP_DIR/bp_test/in/read_sff.in -n 1 -c -O
$BP_TMP/rajkump.read_sff.out ... FAIL
Testing remove_indel_columns -I $BP_DIR/bp_test/in/remove_indel_columns.in -O
$BP_TMP/rajkump.remove_indel_columns.out ... FAIL
Testing remove_primers -f ACTGAGCTAGCAGCGGTGCG -r TGCTGGACTGGGTGGAGCAC -m 0 -i
0 -d 0 -I $BP_DIR/bp_test/in/remove_primers.in -O
$BP_TMP/rajkump.remove_primers.out ... FAIL
Testing scores_to_dec -I $BP_DIR/bp_test/in/scores_to_dec.in -O
$BP_TMP/rajkump.scores_to_dec.out ... FAIL
Testing shred_seq -I $BP_DIR/bp_test/in/shred_seq.in -s 18 -c 2 -O
$BP_TMP/rajkump.shred_seq.out ... FAIL
Testing split_pair_seq -I $BP_DIR/bp_test/in/split_pair_seq.in -O
$BP_TMP/rajkump.split_pair_seq.out ... FAIL
Testing trim_seq -I $BP_DIR/bp_test/in/trim_seq.in -O
$BP_TMP/rajkump.trim_seq.out ... FAIL
Testing trim_seq -I $BP_DIR/bp_test/in/trim_seq.in -m 25 -O
$BP_TMP/rajkump.trim_seq.out ... FAIL
Testing trim_seq -I $BP_DIR/bp_test/in/trim_seq.in -t both -O
$BP_TMP/rajkump.trim_seq.out ... FAIL
Testing trim_seq -I $BP_DIR/bp_test/in/trim_seq.in -t left -O
$BP_TMP/rajkump.trim_seq.out ... FAIL
Testing trim_seq -I $BP_DIR/bp_test/in/trim_seq.in -t right -O
$BP_TMP/rajkump.trim_seq.out ... FAIL
Testing trim_seq -I $BP_DIR/bp_test/in/trim_seq.in -l 4 -O
$BP_TMP/rajkump.trim_seq.out ... FAIL
Testing uclust_seq -I $BP_DIR/bp_test/in/uclust_seq.in -O
$BP_TMP/rajkump.uclust_seq.out ... FAIL
Testing uclust_seq -I $BP_DIR/bp_test/in/uclust_seq.in -i 1 -O
$BP_TMP/rajkump.uclust_seq.out ... FAIL
Testing uclust_seq -I $BP_DIR/bp_test/in/uclust_seq.in -i 1 -c -O
$BP_TMP/rajkump.uclust_seq.out ... FAIL
Testing write_fasta_files -I $BP_DIR/bp_test/in/write_fasta_files.in -d
$BP_TMP/rajkump.test_tmp -k SEQ_NAME -x ... FAIL
Testing write_fasta_files -I $BP_DIR/bp_test/in/write_fasta_files.in -d
$BP_TMP/rajkump.test_tmp -k SEQ_LEN -x ... FAIL
Testing write_fastq -I $BP_DIR/bp_test/in/write_fastq.in -o
$BP_TMP/rajkump.write_fastq.out -x ... FAIL
Testing write_fastq -I $BP_DIR/bp_test/in/write_fastq.in -e base_33 -o
$BP_TMP/rajkump.write_fastq.out -x ... FAIL
Testing write_fastq -I $BP_DIR/bp_test/in/write_fastq.in -e base_64 -o
$BP_TMP/rajkump.write_fastq.out -x ... FAIL
Testing write_fastq -I $BP_DIR/bp_test/in/write_fastq.in -Z -o
$BP_TMP/rajkump.write_fastq.out.gz -x ... FAIL
Testing write_fastq_files -I $BP_DIR/bp_test/in/write_fastq_files.in -d
$BP_TMP/rajkump.test_tmp -k SEQ_NAME -x ... FAIL
Testing write_fastq_files -I $BP_DIR/bp_test/in/write_fastq_files.in -e base_33
-d $BP_TMP/rajkump.test_tmp -k SEQ_NAME -x ... FAIL
Testing write_fastq_files -I $BP_DIR/bp_test/in/write_fastq_files.in -e base_64
-d $BP_TMP/rajkump.test_tmp -k SEQ_NAME -x ... FAIL
Biopieces tested: 80 Tests run: 247 OK: 129 FAIL: 111 WARNING: 7 Time: 27
secs
Please help
Original comment by rajk...@miamioh.edu on 29 Apr 2013 at 3:37
GoogleCodeExporter commented
The best place for support is still the Google Group
http://groups.google.com/group/biopieces.
Now you are encountering an issue with Ruby/Gem/Inline/Zentest. I have battled
with the same. The trick is to run 'gem update --system' and reinstall zentest.
If you are on a debian type system 'gem update' is disabled and you have to do
all sorts of hoops to re-enable that. I find it faster to compile my own ruby
version and build gems on top of that.
Original comment by martinah...@gmail.com on 29 Apr 2013 at 3:51
GoogleCodeExporter commented
I just got a similar problem, I fixed it by replacing Zentest 4.9.1 by Zentest
4.3.0.
1) gem uninstall ZenTest
2) I needed to remove /var/lib/gems/1.9.1/specifications/ZenTest-4.9.1.gemspec
manually
3) gem install ZenTest -v 4.3.0
I hope it will help
cheers
Original comment by ale.gil...@gmail.com on 30 Apr 2013 at 1:33
GoogleCodeExporter commented
Thanks for the reply. I reinstalled Zentest but still the problem persist.
Below I will paste what I did
I removed ZenTest-4.9.1.gemspec and uninstalled Zentest
rajkump@bioinfo-GPU:/var/lib/gems/1.8/specifications$ sudo rm
ZenTest-4.9.1.gemspec
I installed ZenTest -v 4.3.0
Even after that I get the following error message for --->read_fasta
rajkump@bioinfo-GPU:/var/lib/gems/1.8/specifications$ read_fasta
/usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require': cannot load
such file -- narray (LoadError)
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/bits.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/seq.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/code_ruby/lib/maasha/fasta.rb:25:in `<top (required)>'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /usr/lib/ruby/1.9.1/rubygems/custom_require.rb:36:in `require'
from /home/rajkump/Software/biopieces/bp_bin/read_fasta:32:in `<main>'
Original comment by rajk...@miamioh.edu on 30 Apr 2013 at 2:31
GoogleCodeExporter commented
So the error tells us that the narray gem is not installed for /usr/bin/env
ruby. If you already did "gem install narray" the question is which Ruby
installation it was? The comman which ruby and which gem is of great help. Also
ruby --version and gem --version are important.
Original comment by martinah...@gmail.com on 30 Apr 2013 at 4:21