mhalushka/miRge3.0

error

Closed this issue · 3 comments

hust-yyan commented

Hello, my data is Qiagen small RNA-seq. I tried to perform an analysis with the following code, but I encountered the following error.
export PATH=/home/yyan/miniconda3/envs/py3.7/bin:$PATH
outdir=/data1/shiyan_data/mirge
lib=/home/yyan/database/miRge3_Lib
indir=/data1/shiyan_data/plasma_miRNA
sample=$1
/home/yyan/miniconda3/envs/py3.7/bin/miRge3.0 -s $indir/${sample}/${sample}_R1.fastq.gz
-lib ${lib} -on human -db miRBase -o ${outdir}/${sample} --qiagenumi -cpu 3 -q 20 -NX -nmir -minl 16 -maxl 25 -c 2 -mloc 3 -sl 25 -olc 14 -clc 30 -gff -bam -ai -tcf -trf -a AACTGTAGGCACCATCAAT

image

arunhpatil commented

Hi @hust-yyan ,

The error is, it is not finding the umi length. Since it is Qiagen UMI, you need to add this parameter to your command -umi 0,12 (To trim 0 bases at 5′ and 12 bases at 3′ after adapter removal). This 12 is the standard UMI length from Qiagen, you can change the length of UMI sequence if it is not 12 bp. This should solve the issue.

Also, I noticed you have used BAM parameter, I request you to refer this previous issue and download the libarary to result you BAM output . Further, just to test if UMI's are working correctly, I would suggest you minimize the parameters of secondary output as this will save time. Let me know if this works.

Thanks,
Arun.

hust-yyan commented

Hello, thank you for the quick response before.
Now I can run successfully and get the result.
I have another question. In the mapped.csv file, each miRNA has multiple expression values, as shown below. How to understand this?
image

arunhpatil commented

Hi @hust-yyan,

I believe you are looking at mapped.csv file, which reports miRNAs at individual collapsed reads with their read counts. If you are interested at miRNA level expression values, you should be looking at miR.Counts.csv (for counts) or for RPM values, miR.RPM.csv. If you are interested in isomiRs you should be looking at a file with extension .gff (assuming miRge3.0 was run with parameter -gff).

Here cannonical sequence for miR-223-3p is "TGTCAGTTTGTCAAATACCCCA" and the counts for 118,460 corresponds to a non-template addtion of T at the 3' end inplace of an A in the precursor miRNA sequnce. Hope this helps. Let us know if you have any further queries regarding this.

Thank you,
Arun.