error generating insertion

Question

error generating insertion

Esbertrand opened this issue 9 years ago · 7 comments

Hello,

i'm trying to generate fatsq files with dwgsim using a mutation txt file.
It worked perfecty with dwgsim 1.10 but not anymore with the 1.11.
Several indels in my file lead to src/dwgsim.c:760: dwgsim_core: Assertion 0 <= byte_index' failed. or 280000dwgsim: src/dwgsim.c:741: dwgsim_core: Assertion0 <= byte_index' failed.

Here an example of insertion : 1 15439084 - AGGTCTTTTTTTTCTTCTCCCAGCGGC 2

My command : dwgsim -e 0.001-0.01 -E 0.001-0.01 -C ${COVERAGE} -1 100 -2 100 -y 0 -c 0 -r 0 -R 0 -x ${bed} -m ${PROJECTDIR}/test3.txt ${PATHTOREF} ${PROJECTDIR}/'read_simulation_'${Toss}

I attached test3.txt file to this message and the problematic insertion is the last mutation of the file.

Any idea?

Thanks in advance.

Bertrand
test3.txt

Answer 1 · 2016-02-12T13:41:31.000Z

sorry i attached the file without the problematic mutation, this one is the good one
test3.txt

Answer 2 · 2016-02-12T15:40:49.000Z

I'll need to know a coverage value (${COVERAGE}) and the reference sequence (${PATHTOREF}) that you are using. Thanks for posting the bug report!

Answer 3 · 2016-02-12T15:44:31.000Z

coverage 40 and ref human_g1k_v37.fasta

Answer 4 · 2016-07-17T03:17:38.000Z

@Esbertrand my apologies for the delay, but you wouldn't have the ${bed} file still would you?

Answer 5 · 2016-07-17T04:11:31.000Z

@Esbertrand Looks like I was able to reproduce and I have a pull request. Thanks for reporting!

Answer 6 · 2016-07-18T10:55:42.000Z

Hi,

the bed file is attached.
test.txt

Answer 7 · 2016-07-18T15:19:16.000Z

@Esbertrand I have a fix (see #24). I am going to merge it in. Let me know if there are any issues.