hotspotFingerprintCollector

fingerprintsCollector, workflow that generates aligns reads to reference, then creates fingerprints using variousmethods. Output are fingerprints of various types and coverage statistics from the alignment

Overview

Dependencies

Usage

Cromwell

java -jar cromwell.jar run hotspotFingerprintCollector.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter	Value	Description
`inputType`	String	one of either fastq or bam
`aligner`	String	aligner to use for fastq input, either bwa or star
`markDups`	String	should the alignment be duplicate marked?, generally yes
`outputFileNamePrefix`	String	Optional output prefix for the output
`refFasta`	String	Path to the reference fasta file
`hotspots`	String	hotspot file for generateFingerprints
`downsample.modules`	String	Names and versions of modules
`bwaMem.runBwaMem_bwaRef`	String	The reference genome to align the sample with by BWA
`bwaMem.runBwaMem_modules`	String	Required environment modules
`markDuplicates.modules`	String	Names and versions of modules
`assessCoverage.modules`	String	Names and versions of modules
`generateFingerprint.modules`	String	Names and versions of modules
`runFinCreator.modules`	String	Names and versions of modules

Optional workflow parameters:

Parameter	Value	Default	Description
`fastqR1`	File?	None	fastq file for read 1
`fastqR2`	File?	None	fastq file for read 2
`bam`	File?	None	bam file
`bamIndex`	File?	None	bam index file
`maxReads`	Int	0	The maximum number of reads to process; if set, this will sample the requested number of reads

Optional task parameters:

Parameter	Value	Default	Description
`downsample.jobMemory`	Int	8	memory allocated for Job
`downsample.timeout`	Int	24	Timeout in hours, needed to override imposed limits
`bwaMem.adapterTrimmingLog_timeout`	Int	48	Hours before task timeout
`bwaMem.adapterTrimmingLog_jobMemory`	Int	12	Memory allocated indexing job
`bwaMem.indexBam_timeout`	Int	48	Hours before task timeout
`bwaMem.indexBam_modules`	String	"samtools/1.9"	Modules for running indexing job
`bwaMem.indexBam_jobMemory`	Int	12	Memory allocated indexing job
`bwaMem.bamMerge_timeout`	Int	72	Hours before task timeout
`bwaMem.bamMerge_modules`	String	"samtools/1.9"	Required environment modules
`bwaMem.bamMerge_jobMemory`	Int	32	Memory allocated indexing job
`bwaMem.runBwaMem_timeout`	Int	96	Hours before task timeout
`bwaMem.runBwaMem_jobMemory`	Int	32	Memory allocated for this job
`bwaMem.runBwaMem_threads`	Int	8	Requested CPU threads
`bwaMem.runBwaMem_addParam`	String?	None	Additional BWA parameters
`bwaMem.adapterTrimming_timeout`	Int	48	Hours before task timeout
`bwaMem.adapterTrimming_jobMemory`	Int	16	Memory allocated for this job
`bwaMem.adapterTrimming_addParam`	String?	None	Additional cutadapt parameters
`bwaMem.adapterTrimming_modules`	String	"cutadapt/1.8.3"	Required environment modules
`bwaMem.slicerR2_timeout`	Int	48	Hours before task timeout
`bwaMem.slicerR2_jobMemory`	Int	16	Memory allocated for this job
`bwaMem.slicerR2_modules`	String	"slicer/0.3.0"	Required environment modules
`bwaMem.slicerR1_timeout`	Int	48	Hours before task timeout
`bwaMem.slicerR1_jobMemory`	Int	16	Memory allocated for this job
`bwaMem.slicerR1_modules`	String	"slicer/0.3.0"	Required environment modules
`bwaMem.countChunkSize_timeout`	Int	48	Hours before task timeout
`bwaMem.countChunkSize_jobMemory`	Int	16	Memory allocated for this job
`bwaMem.numChunk`	Int	1	number of chunks to split fastq file [1, no splitting]
`bwaMem.trimMinLength`	Int	1	minimum length of reads to keep [1]
`bwaMem.trimMinQuality`	Int	0	minimum quality of read ends to keep [0]
`bwaMem.adapter1`	String	"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"	adapter sequence to trim from read 1 [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC]
`bwaMem.adapter2`	String	"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"	adapter sequence to trim from read 2 [AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT]
`star.indexBam_timeout`	Int	48	hours before task timeout
`star.indexBam_modules`	String	"picard/2.19.2"	modules for running indexing job
`star.indexBam_jobMemory`	Int	12	Memory allocated indexing job
`star.runStar_timeout`	Int	72	hours before task timeout
`star.runStar_jobMemory`	Int	64	Memory allocated for this job
`star.runStar_threads`	Int	6	Requested CPU threads
`star.runStar_peOvMMp`	Float	0.1	maximum proportion of mismatched bases in the overlap area
`star.runStar_chimSegmentReadGapMax`	Int	3	maximum gap in the read sequence between chimeric segments
`star.runStar_peOvNbasesMin`	Int	10	minimum number of overlap bases to trigger mates merging and realignment
`star.runStar_chimOutJunForm`	Int?	None	flag to add metadata to chimeric junction output for functionality with starFusion - 1 for metadata, 0 for no metadata
`star.runStar_chimNonchimScoDMin`	Int	10	to trigger chimeric detection, the drop in the best non-chimeric alignment score with respect to the read length has to be greater than this value
`star.runStar_chimMulmapNmax`	Int	50	maximum number of chimeric multi-alignments
`star.runStar_chimScoreSeparation`	Int	1	minimum difference (separation) between the best chimeric score and the next one
`star.runStar_chimScoJunNonGTAG`	Int	0	penalty for a non-GTAG chimeric junction
`star.runStar_chimMulmapScoRan`	Int	3	the score range for multi-mapping chimeras below the best chimeric score
`star.runStar_alignIntMax`	Int	100000	maximum intron size
`star.runStar_alignMatGapMax`	Int	100000	maximum gap between two mates
`star.runStar_alignSJDBOvMin`	Int	10	minimum overhang for annotated spliced alignments
`star.runStar_chimJunOvMin`	Int	10	minimum overhang for a chimeric junction
`star.runStar_chimSegmin`	Int	10	minimum length of chimeric segment length
`star.runStar_multiMax`	Int	-1	multiMax parameter for STAR
`star.runStar_saSparsed`	Int	2	saSparsed parameter for STAR
`star.runStar_uniqMAPQ`	Int	255	Score for unique mappers
`star.runStar_chimScoreDropMax`	Int	30	max drop (difference) of chimeric score (the sum of scores of allchimeric segments) from the read length
`star.runStar_outFilterMultimapNmax`	Int	50	max number of multiple alignments allowed for a read: if exceeded, the read is considered unmapped
`star.runStar_modules`	String	"star/2.7.6a hg38-star-index100/2.7.6a"	modules for running STAR
`star.runStar_addParam`	String?	None	Additional STAR parameters
`star.runStar_genereadSuffix`	String	"ReadsPerGene.out"	ReadsPerGene file suffix
`star.runStar_chimericjunctionSuffix`	String	"Chimeric.out"	Suffix for chimeric junction file
`star.runStar_transcriptomeSuffix`	String	"Aligned.toTranscriptome.out"	Suffix for transcriptome-aligned file
`star.runStar_starSuffix`	String	"Aligned.sortedByCoord.out"	Suffix for sorted file
`star.runStar_genomeIndexDir`	String	"$HG38_STAR_INDEX100_ROOT/"	Path to STAR index
`markDuplicates.jobMemory`	Int	24	memory allocated for Job
`markDuplicates.overhead`	Int	6	memory allocated to overhead of the job other than used in markDuplicates command
`markDuplicates.timeout`	Int	24	Timeout in hours, needed to override imposed limits
`assessCoverage.jobMemory`	Int	8	memory allocated for Job
`assessCoverage.timeout`	Int	24	Timeout in hours, needed to override imposed limits
`generateFingerprint.jobMemory`	Int	8	memory allocated for Job
`generateFingerprint.timeout`	Int	24	Timeout in hours, needed to override imposed limits
`generateFingerprint.stdCC`	Float	30.0	tunable standard call confidence score parameter for gatk, default is 30
`runFinCreator.chroms`	Array[String]	["chr1", "chr2", "chr3", "chr4", "chr5", "chr6", "chr7", "chr8", "chr9", "chr10", "chr11", "chr12", "chr13", "chr14", "chr15", "chr16", "chr17", "chr18", "chr19", "chr20", "chr21", "chr22", "chrX"]	Canonical chromosomes in desired order (used for soting lines in .fin file)
`runFinCreator.timeout`	Int	10	Timeout in hours, needed to override imposed limits
`runFinCreator.jobMemory`	Int	8	memory allocated for Job

Outputs

Output	Type	Description	Labels
`coverage`	File	output from samtools coverage, with per chromosome metrics	vidarr_label: coverage
`json`	File	metrics in json format, currently only the mean coverage for the alignment	vidarr_label: json
`hotspotVcf`	File	vcf file from GATK haplotype caller on provided hotspots	vidarr_label: hotspotVcf
`hotspotTbi`	File	index for the vcf hotspot fingerprint	vidarr_label: hotspotTbi
`hotspotFin`	File	fingerprint Fin file for the provided hotspots	vidarr_label: hotspotFin

Commands

This section lists command(s) run by hotspotFingerprintsCollector workflow

Running hotspotFingerprintsCollector

Commands for downsampling

  set -euo pipefail
  
  seqtk sample -s 100 INPUT_FASTQ_R1 maxReads > OUTPUT_FATSQ_R1m
  gzip OUTPUT_FATSQ_R1m
  
  seqtk sample -s 100 INPUT_FASTQ_R2 maxReads > OUTPUT_FATSQ_R2m
  gzip OUTPUT_FATSQ_R2m

Command for markDuplicates

   set -euo pipefail
   $GATK_ROOT/bin/gatk --java-options "-Xmx [JOB_MEMORY] - [OVERHEAD]G" MarkDuplicates \
                       -I INPUT_Bam \
                       --METRICS_FILE OUTPUT_FILE_NAME_PREFIX.dupmetrics \
                       --VALIDATION_STRINGENCY SILENT \
                       --CREATE_INDEX true \
                       -O OUTPUT_FILE_NAME_PREFIX.dupmarked.bam

Commands for generateFingerprint

   set -euo pipefail
   $SAMTOOLS_ROOT/bin/samtools coverage INPUT_BAM > OUTPUT_FILE_NAME_PREFIX.coverage.txt
   cat OUTPUT_FILE_NAME_PREFIX.coverage.txt | grep -P "^chr\d+\t|^chrX\t|^chrY\t" | awk '{ space += ($3-$2)+1; bases += $7*($3-$2);} END { print bases/space }' | awk '{print "{\"mean coverage\":" $1 "}"}' > OUTPUT_FILE_NAME_PREFIX.json
 
 
  set -euo pipefail
  $GATK_ROOT/bin/gatk HaplotypeCaller \
                     -R refFasta \
                     -I INPUT_BAM \
                     -O OUTPUT_FILE_NAME_PREFIX.hotspots.vcf \
                     --read-filter CigarContainsNoNOperator \
                     --stand-call-conf stdCC \
                     -L hotspots
 
  $TABIX_ROOT/bin/bgzip -c OUTPUT_FILE_NAME_PREFIX.hotspots.vcf > OUTPUT_FILE_NAME_PREFIX.hotspots.vcf.gz
  $TABIX_ROOT/bin/tabix -p vcf OUTPUT_FILE_NAME_PREFIX.hotspots.vcf.gz 
  
  $GATK_ROOT/bin/gatk DepthOfCoverage \
                      -R refFasta \
                      -I INPUT_BAM \
                      -O OUTPUT_FILE_NAME_PREFIX \
                      --read-filter CigarContainsNoNOperator \
                      -L hotspots

Support

For support, please file an issue on the Github project or send an email to gsi@oicr.on.ca .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)

oicr-gsi/hotspotFingerprintCollector