probeCoverageDistribution

Workflow to visualize probe coverage

Overview

Dependencies

Usage

Cromwell

java -jar cromwell.jar run probeCoverageDistribution.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter	Value	Description
`bed`	String	File path to target probes, genomic coordinates of the targeted regions in tab-delimited text format.
`outputFileNamePrefix`	String	Optional output prefix to prefix output file names with.
`inputType`	String	fastq or bam to indicate type of input.
`bwaMem.runBwaMem_bwaRef`	String	The reference genome to align the sample with by BWA
`bwaMem.runBwaMem_modules`	String	Required environment modules

Optional workflow parameters:

Parameter	Value	Default	Description
`fastqR1`	File?	None	fastq file for read 1 (optional).
`fastqR2`	File?	None	fastq file for read 2 (optional).
`bam`	File?	None	Alignment file (optional).
`bamIndex`	File?	None	Alignment file index (optional).
`partition`	String?	None	Comma separated string indicating pool(s) to be viewed separately in the plots (example: "exome,pool_1").

Optional task parameters:

Parameter	Value	Default	Description
`bwaMem.adapterTrimmingLog_timeout`	Int	48	Hours before task timeout
`bwaMem.adapterTrimmingLog_jobMemory`	Int	12	Memory allocated indexing job
`bwaMem.indexBam_timeout`	Int	48	Hours before task timeout
`bwaMem.indexBam_modules`	String	"samtools/1.9"	Modules for running indexing job
`bwaMem.indexBam_jobMemory`	Int	12	Memory allocated indexing job
`bwaMem.bamMerge_timeout`	Int	72	Hours before task timeout
`bwaMem.bamMerge_modules`	String	"samtools/1.9"	Required environment modules
`bwaMem.bamMerge_jobMemory`	Int	32	Memory allocated indexing job
`bwaMem.runBwaMem_timeout`	Int	96	Hours before task timeout
`bwaMem.runBwaMem_jobMemory`	Int	32	Memory allocated for this job
`bwaMem.runBwaMem_threads`	Int	8	Requested CPU threads
`bwaMem.runBwaMem_addParam`	String?	None	Additional BWA parameters
`bwaMem.adapterTrimming_timeout`	Int	48	Hours before task timeout
`bwaMem.adapterTrimming_jobMemory`	Int	16	Memory allocated for this job
`bwaMem.adapterTrimming_addParam`	String?	None	Additional cutadapt parameters
`bwaMem.adapterTrimming_modules`	String	"cutadapt/1.8.3"	Required environment modules
`bwaMem.slicerR2_timeout`	Int	48	Hours before task timeout
`bwaMem.slicerR2_jobMemory`	Int	16	Memory allocated for this job
`bwaMem.slicerR2_modules`	String	"slicer/0.3.0"	Required environment modules
`bwaMem.slicerR1_timeout`	Int	48	Hours before task timeout
`bwaMem.slicerR1_jobMemory`	Int	16	Memory allocated for this job
`bwaMem.slicerR1_modules`	String	"slicer/0.3.0"	Required environment modules
`bwaMem.countChunkSize_timeout`	Int	48	Hours before task timeout
`bwaMem.countChunkSize_jobMemory`	Int	16	Memory allocated for this job
`bwaMem.numChunk`	Int	1	number of chunks to split fastq file [1, no splitting]
`bwaMem.trimMinLength`	Int	1	minimum length of reads to keep [1]
`bwaMem.trimMinQuality`	Int	0	minimum quality of read ends to keep [0]
`bwaMem.adapter1`	String	"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"	adapter sequence to trim from read 1 [AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC]
`bwaMem.adapter2`	String	"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"	adapter sequence to trim from read 2 [AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT]
`getGenomeFile.jobMemory`	Int	10	Memory (in GB) allocated for job.
`getGenomeFile.timeout`	Int	4	Maximum amount of time (in hours) the task can run for.
`getGenomeFile.modules`	String	"samtools/1.14"	Environment module names and version to load (space separated) before command execution.
`calculateProbeCoverageDistribution.jobMemory`	Int	10	Memory (in GB) allocated for job.
`calculateProbeCoverageDistribution.timeout`	Int	4	Maximum amount of time (in hours) the task can run for.
`calculateProbeCoverageDistribution.modules`	String	"bedtools/2.27"	Environment module names and version to load (space separated) before command execution.
`Rplot.partition`	String?	None	Comma separated string indicating pool(s) to be viewed separately in the plots (example: "exome,pool_1").
`Rplot.jobMemory`	Int	20	Memory (in GB) allocated for job.
`Rplot.timeout`	Int	4	Maximum amount of time (in hours) the task can run for.
`Rplot.modules`	String	"probe-coverage-distribution/2.0"	Environment module names and version to load (space separated) before command execution.
`RplotPartioned.jobMemory`	Int	20	Memory (in GB) allocated for job.
`RplotPartioned.timeout`	Int	4	Maximum amount of time (in hours) the task can run for.
`RplotPartioned.modules`	String	"probe-coverage-distribution/2.0"	Environment module names and version to load (space separated) before command execution.
`compressResults.jobMemory`	Int	12	Memory for the task, in gigabytes
`compressResults.timeout`	Int	4	Timeout for the task, in hours

Outputs

Output	Type	Description	Labels
`cvgFile`	File	Coverage histogram, tab-delimited text file reporting the coverage at each feature in the bed file.	vidarr_label: cvgFile
`plots`	File	A compress file of all the Rplots created by the workflow, which show interval panel coverage.	vidarr_label: plots

Commands

This section lists command(s) run by the probeCoverageDistribution workflow

Running probeCoverageDistribution workflow

Capture panels are defined by a set of intervals defined in a bed file. This workflow uses bedtools to obtain bam coverage of the set of intervals and produces summary plots to visualize probe coverage and assess performance.

Create genome file to use bedtools sorted to estimate coverage

     samtools view -H ~{inputBam} | \
     grep @SQ | sed 's/@SQ\tSN:\|LN://g' \
     > genome.txt

Calculate coverage using bedtools

     bedtools coverage -hist \
     -a ~{inputBed} \
     -b ~{inputBam} \
     -sorted -g ~{genomeFile} \
     > ~{outputPrefix}.cvghist.txt || echo "Bedtools failed to produce output" \
     | rm ~{outputPrefix}.cvghist.txt
     #use or "||" when command fails otherwise workflow succeeds on empty file

Run custom Rscript to plot coverage

     Rscript --vanilla $PROBE_COVERAGE_DISTRIBUTION_ROOT/plot_coverage_histograms.R \
     -b ~{inputBed} -c ~{coverageHist} -o ~{outputPrefix} ~{"-l " + partition}

Compress plots

     set -euo pipefail
     mkdir ~{outputPrefix}
     cp -t ~{outputPrefix} ~{sep=' ' inFiles}
     tar -zcvf "~{outputPrefix}_plots.tar.gz" "~{outputPrefix}"

Support

For support, please file an issue on the Github project or send an email to gsi@oicr.on.ca .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)

oicr-gsi/probeCoverageDistribution