/bioinformatics-tools

Small and simple scripts useful for various bioinformatics purposes e.g. extract sequences from fasta files

Primary LanguageShellGNU General Public License v3.0GPL-3.0

informatics-tools

Some small and simple programs useful for various bioinformatics purposes.

1. extract-contigs.pl

This convenient Perl script is able to extract contigs of FASTA files either by contig name or a list of contig names.

$ extract-contigs.pl single CONTIGNAME FASTAFILE

or with a list of contigs

$ extract-contigs.pl list LISTNAME FASTAFILE

To save into a new file, use ">" sign

$ extract-contigs.pl list LISTNAME FASTAFILE > NEW_FILENAME

2. ver-horizontal.sh

This Bash script converts a list to horizontal view on the standard output for various automation purposes.

$ ver-horizontal.sh LIST

For instance, a file named LIST

hello
world
happy

will be converted to

hello world happy

3. assembly-stats.pl

This Perl script gives you general assembly statistics including contig number, genome size, largest contig (bases), GC content, N count and gap count. It takes the inputs of FASTA assemblies.

$ assembly-stats.pl FASTAFILE

It generates data on standard output as follows:

Sample_ID  Genome  Contigs Mean    Median  N50     Largest GC(%)   N_count N(%)    Gap_count
test.fasta 158     2       79      89      89      89      5.95    26      16.46   4

Output explanations

  • Genome: Genome size
  • Contigs: Number of contigs in the fasta file
  • Mean: Average size of contigs in bases
  • Median: Size of median contig
  • N50: Yardstick of assembly quality - 50% of the contigs are larger than this size (in nucleotide bases)
  • Largest: Size (nucleotide bases) of largest contigs
  • GC(%): GC (guanine and cytosine) content of the genome
  • N_count: Number of N found in the genome (uncertain base calling)
  • N(%): N count in percentage
  • Gap_count: count "-" in the fasta file, usually appears in alignment file

4. reverse-complement.sh

This Bash script generates reverse complement for nucleotide FASTA files. That is, A -> T, G -> C and vice versa.

$ reverse-complement.sh -o OUTPUT_FILENAME FASTAFILE

Option -o can be omitted, the default output filename is FASTAFILE-complement.fasta

5. basename_dir.sh

This one-line bash script is able to extract the basenames of files with same suffixes for various purposes. If a directory has 3 files with suffixes .fasta namely ABC.fasta, CDE.fasta and EFG.fasta, usage is below:

$ basename_dir.sh .fasta

It will print on standard output:

$ ABC CDE EFG

6. extract-sequences-ids.sh

This Bash script is superquick at extracting sequences (or, contigs if you like) from multifasta files using an external file of ids list and display on the standard output.

$ extract-sequences-ids.sh ids multifasta

You can do the below for usage options:

$ extract-sequences-ids.sh -h

This bash script can extract sequences from multifasta files using sequence ids

Usage: extract-sequences-ids.sh [options] ids.file multifasta.file
Options:
 -h print usage and exit
 -a print author and exit
 -v print version and exit
 

You will see something like this on the standard output:

>ABC123
ATGATAAGATTTAAGAAAACAAAATTAATAGCAAGTATTGCAATGGCTTTATGTCTGTTT
TCTCAACCAGTAATCAGTTTCTCAAAGGATATAACAGATAAAAATCAAAGTATTGATTCT
GGAATATCAAGCTTAAGTTACAATAGAAATGAAGTTTTAGCTAGTAATGGAGATAAAATT
GAAAGTTTTGTTCCAAAGGAAGGTAAAAAGACTGGTAATAAATTTATAGTTGTAGAACGT
CAAAAAAGATCCCTTACAACATCACCAGTAGATATATCAATAATTGATTCTGTAAATGAC

To generate the ids file, use vim editor and create any file name e.g. ids and enter the sequence ids line by line

ABC123
DMF123
dlfppt

7. contigs-ids-length.sh

This script estimates the length of each contig in a multi-fasta file.

8. filter-contig.pl

This script filters genome assembly by specifying minimum contig length. For example, too filter out contigs with <500 bp,

$ filter-contig.pl 500 fasta

9. atgc2ATGC.sh

This bash script converts atgc to ATGC using AWK - super fast, >300MB fasta file in under 15 seconds.

10. rename_contigs.sh

This script renames contigs in multi-fasta files.

$ rename_contigs.sh fasta PREFIX

For example (123.fasta is your fasta file, ABC is the prefix you want to use for renaming your contigs)

$ rename_contigs.sh 123.fasta ABC
>ABC.1
ATGCATGC
>ABC.2
AGGTCTCT
>ABC.3
AGGGCCGT

So use > to save into new fasta file, e.g.

$ rename_contigs.sh 123.fasta ABC > ABC.fna