Program crash with "Assertion `dna.size()==qual.size()' failed."
aersoares81 opened this issue · 5 comments
Hi, I've been using NxTrim for a while, and never saw this happen before:
nxtrim: fastqlib.cpp:30: int fqread::set(std::string, std::string, std::string, std::string): Assertion dna.size()==qual.size()' failed.`
Is there something wrong with the sequencing files? Or is it just a bug? Thanks!
Is there something wrong with the sequencing files? Or is it just a bug? Thanks!
Hard to say because my error message is very uninformative.
I have just pushed a small change to master that will better describe the error. Can you pull the latest commit, re-compile and run it again? The error message will now print out the problematic fastq entry and we can see if it is a bug or a problem with the input.
best,
Jared
I'm doing it right now, thanks for the super fast reply!!
I see what happened now:
HWI-ST1293:232:HBBJ1ADXX:1:1105:15491:89448 1:N:0:CTTGTA
GGAGAAGGATGCAGGAAAGAACTCTGCTTACCATTTGCATCCTGGTTTCTCAGTGC
+
CCCFFFFFHHHHHJJJJJFHIJJJJJJJJJJJJIJJJJJJJJJJIJJJJJJJJJJJJJJIJJJJJJJJJJJJJJHHHHFFFFFFDEEDDDDDDDDDDDDED
ERROR: base length was not equal to qual length in read
That's so weird, I've never seen that before. For some reason I have this:
@HWI-ST1293:232:HBBJ1ADXX:1:1105:15340:89443 1:N:0:CTTGTA
ACTTGATGATCTCCAAGGTCTTTTCCAGCCTTGCTGATTCTGTGTTTCTCTGAAACCACCCCTGCAGAATTTGCAGGATGAGCCCTGGGCCTCCTCTTCAG
+
CCCFFFFFHHHHHJJJJJFHIJJJJJJJJJJJJIJJJJJJJJJJIJJJJJJJJJJJJJJIJJJJJJJJJJJJJJHHHHFFFFFFDEEDDDDDDDDDDDDED
@HWI-ST1293:232:HBBJ1ADXX:1:1105:15491:89448 1:N:0:CTTGTA
GGAGAAGGATGCAGGAAAGAACTCTGCTTACCATTTGCATCCTGGTTTCTCAGTGC@HWI-ST1293:232:HBBJ1ADXX:1:1107:13037:1427 1:N:0:CTTGTA
NTAGATGTGTATAAGAGACAGGTATACAAGAACAAAACCACACTTTTTATTTCATTTTCTAAATTAACATAATATACAGCATGAAATAGAAAACAAGAAGC
+
#1=DDFFFHHHHHJJJJJJJJIHHJIIJJJJJJJJJJIIIJJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJJJJJJJHHHHHFFFFFFFEEEEDDDDDDD
That is new to me. Is the second text box your input fastq? Was any pre-processing applied?
No pre-processing at all, but I'll check with the processing facility, it's likely they concatenated broken fastq files. Thanks for the nicer error message, and for looking at that so fast!
Edit: Yep, that's what they did. Thanks again for the new error message!