This script will first calculate, for each nucleotide position, the %GC of the surrounding nucleotid sequence according to the window size. For the first nucleotid, half of the window size will be taken from the end of the sequence, because this script has been developped for cicular genoms. Then, i will print a value of % each "step" nucleotides
Input file must look like :
\>my_sequence
ATGTGGCTTCGCTTGCTCTCGCTTCG
ATGTGGCTTCGCTTGCTCTCGCTTCG
#Usage
perl gc_content.pl --fasta genome.fasta [--window 1000] [--step 100] [--log] [--help]
arguments details :
--fasta one fasta file that can contain multiple sequences. In that case the script will produce as many output files as input sequences. Each sequence can be multiline.
--window optional. Window size, even number ONLY. Sets the number of nucleotides used to calculate the %GC value of each position. Default 1000
--step optional. step size. The output will contain a sliding GC% value every "step" nucleotides. The numbers of values you get is therefore (length genome)/(step). Default 100
--log optional. for debugging purposes only
--help optional. Shows this help
#Output files
genome.fasta.gc_content
column 1: "chr1" for convenience when the program is used to create an input for Circos (http://www.circos.ca/)
column 2: start position of interval
column 3: end position of interval
column 4: GC% of the interval
example:
chr1 1 100 0.499
chr1 101 200 0.5
chr1 201 300 0.5
chr1 301 400 0.5
chr1 401 500 0.5
chr1 501 600 0.5
chr1 601 700 0.499
chr1 701 800 0.5
genome.fasta.gc_deviation
column 1: "chr1" for convenience when the program is used to create an input for Circos (http://www.circos.ca/)
column 2: start position of interval
column 3: end position of interval
column 4: GC deviation of the interval
example:
chr1 1 100 0.162
chr1 101 200 0.16
chr1 201 300 0.16
chr1 301 400 0.16
chr1 401 500 0.16
chr1 501 600 0.16
chr1 601 700 0.162