FALDO is the Feature Annotation Location Description Ontology. It is a simple ontology to describe sequence feature positions and regions as found in GFF3, DBBJ, EMBL, GenBank files, UniProt, and many other bioinformatics resources.
The aim of this ontology is to describe the position of a sequence region or a feature. It does not aim to describe features or regions itself, but instead depends on resources such as the Sequence Ontology or the UniProt core ontolgy.
You can read more about it our pre print describing FALDO
The examples in turtle avoid declaring prefixes for space reasons.
faldo:Region A genomic region where we know exactly where it starts and ends on the reference genome sequence:
_:1 a faldo:Region ;
faldo:begin _:1b ;
faldo:end _:1e .
_:1b a faldo:Position ;
a faldo:ExactPosition ;
a faldo:ForwardStrandPosition ;
faldo:position "1"^^xsd:integer ;
faldo:reference ddbj:XXXDSDS .
_:1e a faldo:Position ;
a :FuzzyPosition ;
a :ForwardStrandPosition ;
faldo:begin _:1ea ;
faldo:end _:1eb ;
faldo:reference ddbj:XXXDSDS .
_:1ea a faldo:Position ;
a faldo:ExactPosition ;
a faldo:ForwardStrandPosition ;
faldo:position "3"^^xsd:integer ;
faldo:reference ddbj:XXXDSDS .
_:1eb a faldo:Position ;
a faldo:ExactPosition ;
a faldo:ForwardStrandPosition ;
faldo:position "7"^^xsd:integer ;
faldo:reference ddbj:XXXDSDS .A genomic region where the begin is on one contig and the end on an other:
_:2 a faldo:Region
faldo:begin _:2b ;
faldo:end _:2e .
_:2b a faldo:Position ;
a faldo:ExactPosition ;
faldo:position "1"^^xsd:integer ;
faldo:reference _:contig17 .
_:2e a faldo:Position;
a faldo:ExactPosition ;
faldo:position "4"^^xsd:integer ;
faldo:reference _:contig29 .A rather curcial difference with most begin and end conventions here they are biological begin and end. Not smallest number is start and the larger number is end.
----->increasing count of position
123456789012345678901234567890
actgacgactagatcgatcgatcgactagt
tgactgctgatctagctagctagctgatca
<----- direction of transcription
| |--transcription on reverse strand begins here
|--transcription on reverse strand ends here
For example the cheY gene in
Escherichia coli str. K-12 substr. MG1655
is described in the INSDC feature table as complement(1965072..1965461),
which is 390 base pairs using inclusive one-based counting. In FALDO
_:geneCheY a <http://purl.obolibrary.org/obo/SO_0000704> ; # A gene as defined by the Sequence Ontology
rdfs:label "cheY" ;
faldo:location _:example ;
uniprot:P0AE67 up:encodedBy _:geneCheY .
_:example a faldo:Region ;
faldo:begin _:example_b ;
faldo:end _:example_e .
_:example_b a faldo:Position ,
faldo:ExactPosition ,
faldo:ReverseStrandPosition ;
faldo:position "1965461"^^xsd:integer ; #see the end is smaller than the begin
faldo:reference refseq:NC_000913.2 .
_:example_e a faldo:Position ,
faldo:ExactPosition ,
faldo:ReverseStrandPosition ;
faldo:position "1965072"^^xsd:integer ; #see the end is smaller than the begin
faldo:reference refseq:NC_000913.2 .Assume we have a protein aminoacid sequence "ACK" and a massspectrometry experiment says the amino acid A or C is glycosylated. But we don't know which of the two it is. We do know it is not "K".
_:glysolyatedAminoAcid a glycan:glycol:glycosylated_AA ; #The glycan ontology is used here
faldo:location _:fuzzyPosition .
_:fuzzyPosition a faldo:FuzzyPosition ,
faldo:InRangePosition ;
faldo:begin _:exactBegin ;
faldo:end _:exactEnd .
_:faldoBegin a faldo:ExactPosition ;
faldo:position 1 ;
faldo:refence _:sequence .
_:faldoEnd a faldo:ExactPosition ;
faldo:position 2 ;
faldo:refence _:sequence .
_:sequence a uniprot:Sequence ;
rdf:value "ACK" .In the above example uniprot and glyco refer to the glycoprotein and uniprot schema's.
Here we have a begin position that could be one of two nucleotides. This case uses a probablisitic model that denotes that the feature could start at both positions 1 or 2. Position 1 has a likelihood of 0.1 and position 2 has a likelihood of 0.9.
_:3 a faldo:Region faldo:begin ;
faldo:begin _:3b ;
faldo:end _:3e .
_:3b a faldo:ProbablePosition ;
faldop:posibilities(_:3bp1,_:3bp2) .
_:3bp1 a faldop:ProbablePosition ;
faldop:probability "0.1"^^xsd:double ;
faldop:location _:3bb1 .
_:3bp2 a faldop:ProbablePosition ;
faldop:probability "0.9"^^xsd:double ;
faldop:location _:3bb2 .
_:3bb1 a faldo:Position ,
faldo:ExactPosition ;
faldo:position "1"^^xsd:integer ;
faldo:reference _:1Strand .
_:3bb2 a faldo:Position ,
faldo:ExactPosition ;
faldo:position "2"^^xsd:integer ;
faldo:reference _:1Strand .
###Conversion into different RDF/XML FALDO being maintained in faldo.ttl can be converted into RDF/XML using for example the rapper tools.
rapper -i turtle -o rdfxml-abbrev faldo.ttl > faldo.rdf
It can also be converted into rdfxml that can be transformed with the owl2xhtml.xsl stylesheet into a documentation webpage. For that the following code is helpfull.
xsltproc owl2xhtml.xsl faldo.rdf > faldo.html