git clone git@github.com:tfuji/rdf-convert-plantgarden.git
cd rdf-convert-plantgarden
convert plantgardern metadata to rdf
perl scripts/make_ttl_species.pl speciesCode.tsv >speciesCode.ttl
perl scripts/make_ttl_primer.pl Lotus_japonicus.mapped_marker.tsv > Lotus_japonicus.mapped_marker.ttl
perl scripts/make_ttl_gff3.pl Lj3.0_gene_models2.gff3 > Lj3.0_gene_models2.ttl
perl scripts/make_ttl_hayai.pl t34305.G002_import_gene.tsv > t34305.G002_import_gene.ttl
perl scripts/make_ttl_qtl.pl 5dfc6033916f4.tsv >5dfc6033916f4.ttl
[木 10 31 16:34] tf@/tga/services/virtuoso7dev/var/lib/virtuoso/db
%pwd
/tga/services/virtuoso7dev/var/lib/virtuoso/db
[木 10 31 16:34] tf@/tga/services/virtuoso7dev/var/lib/virtuoso/db
%/tga/services/virtuoso7dev/bin/virtuoso-t
[木 10 31 16:34] tf@/tga/services/virtuoso7dev/var/lib/virtuoso/db
% /tga/services/virtuoso7dev/bin/isql 1111 dba dba
Connected to OpenLink Virtuoso
Driver: 07.00.3207 OpenLink Virtuoso ODBC Driver
OpenLink Interactive SQL (Virtuoso), version 0.9849b.
Type HELP; for help and EXIT; to exit.
% /tga/services/virtuoso7dev/bin/isql 1111 dba dba
Connected to OpenLink Virtuoso
Driver: 07.00.3207 OpenLink Virtuoso ODBC Driver
OpenLink Interactive SQL (Virtuoso), version 0.9849b.
Type HELP; for help and EXIT; to exit.
SQL> ld_dir('repos/rdf-converter-plantgarden', 'L*.ttl', 'https://plantgarden.jp/');
Done. -- 7 msec.
SQL> rdf_loader_run();
Done. -- 9350 msec.
SQL> checkpoint ;
Done. -- 2160 msec.
SQL>
http://localhost:8890
PREFIX rdf:<http://www.w3.org/1999/02/22-rdf-syntax-ns#>
PREFIX rdfs:<http://www.w3.org/2000/01/rdf-schema#>
PREFIX obo:<http://purl.obolibrary.org/obo/>
PREFIX insdc:<http://ddbj.nig.ac.jp/ontologies/nucleotide/>
PREFIX faldo: <http://biohackathon.org/resource/faldo#>
PREFIX : <https://plantgardden.jp/ns/>
select
?feature ?type ?faldo_reference
IF(?fstart < ?fend , ?fstart, ?fend) as ?start
IF(?fstart < ?fend , ?fend, ?fstart) as ?end
IF( ?faldo_type = faldo:ForwardStrandPosition,"+", IF( ?faldo_type = faldo:ReverseStrandPosition,"-",".")) as ?strand
FROM <https://plantgarden.jp/>
WHERE
{
{
values ?type { obo:SO_0000704}
values ?faldo_type { faldo:ForwardStrandPosition faldo:ReverseStrandPosition }
?feature rdf:type ?type .
#?type rdfs:label ?feature_type .
?feature faldo:location ?faldo .
?faldo faldo:begin/rdf:type ?faldo_type .
?faldo faldo:begin/faldo:position ?fstart .
?faldo faldo:begin/faldo:reference ?faldo_reference .
?faldo faldo:end/faldo:position ?fend .
} UNION {
values ?type {obo:SO_0000207}
values ?faldo_type { faldo:ForwardStrandPosition faldo:ReverseStrandPosition }
?feature rdf:type ?type .
#?type rdfs:label ?feature_type .
#OPTIONAL{
?feature :has_forword_primer/faldo:location ?faldo .
?faldo faldo:begin/rdf:type ?faldo_type .
?faldo faldo:begin/faldo:position ?fstart .
?faldo faldo:begin/faldo:reference ?faldo_reference .
?faldo faldo:end/faldo:position ?fend .
}
}
ORDER BY ?faldo_reference ?start
limit 10000
@prefix : <https://plantgardden.jp/ns/> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix dc: <http://purl.org/dc/terms/> .
@prefix obo: <http://purl.obolibrary.org/obo/> .
@prefix faldo: <http://biohackathon.org/resource/faldo#> .
<https://plantgarden.jp/en/list/t3747/marker/t3747.M000001.1> rdf:type obo:SO_0000207 ;
dc:identifier "t3747.M000002.1" ;
:species_id "t3747" ;
:has_species <https://plantgarden.jp/en/list/t3747> ;
rdfs:label "FAES0002" ;
:sub_number 1 ;
:marker_type "SSR" ;
:mapped_genome_id "t3747.G002" ;
:has_species <https://plantgarden.jp/en/list/t3747/genome/t3747.G002> ;
:reference_seq_name "v1.0.a1" ;
:chr "Fvb6-1" ;
:target_seq "NA" ;
:allele "NA" ;
:enzyme "NA" ;
rdfs:comment "<i>F. x ananassa</i> EST-SSR" ;
:doi "NA" ;
dc:references "NA" ;
:f_active "1" ;
:has_forword_primer <https://plantgarden.jp/en/list/t3747/marker/t3747.M000001.1#Fvb6-1:forword-primer> ;
:has_reverse_primer <https://plantgarden.jp/en/list/t3747/marker/t3747.M000001.1#Fvb6-1:reverse-primer> .
<https://plantgarden.jp/en/list/t3747/marker/t3747.M000001.1#Fvb6-1:forword-primer> faldo:location [
rdf:type faldo:Region ;
rdf:type obo:SO_0000121 ;
rdfs:label "t3747.M000001.1:fwd" ;
:sequence "GCAACAACAGCTCTCGCATA" ;
faldo:begin [
faldo:position 22027099 ;
faldo:reference <https://plantgarden.jp/en/list/t3747/sequence/Fvb6-1> ;
rdf:type faldo:ExactPosition ;
rdf:type faldo:ForwardStrandPosition
] ;
faldo:end [
faldo:position 22027118 ;
faldo:reference <https://plantgarden.jp/en/list/t3747/sequence/Fvb6-1> ;
rdf:type faldo:ExactPosition ;
rdf:type faldo:ForwardStrandPosition
]
] .
<https://plantgarden.jp/en/list/t3747/marker/t3747.M000001.1#Fvb6-1:reverse-primer> faldo:location [
rdf:type faldo:Region ;
rdf:type obo:SO_0000132 ;
rdfs:label "t3747.M000001.1:fwd" ;
:sequence "GACTATCTCCGCCATCCAAA" ;
faldo:begin [
faldo:position 22027216 ;
faldo:reference <https://plantgarden.jp/en/list/t3747/sequence/Fvb6-1> ;
rdf:type faldo:ExactPosition ;
rdf:type faldo:ForwardStrandPosition
] ;
faldo:end [
faldo:position 22027197 ;
faldo:reference <https://plantgarden.jp/en/list/t3747/sequence/Fvb6-1> ;
rdf:type faldo:ExactPosition ;
rdf:type faldo:ForwardStrandPosition
]
] .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix : <https://plantgardden.jp/ns/> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix dc: <http://purl.org/dc/terms/> .
@prefix obo: <http://purl.obolibrary.org/obo/> .
@prefix faldo: <http://biohackathon.org/resource/faldo#> .
@prefix sio: <http://semanticscience.org/resource/> .
<https://plantgarden.jp/en/list/t34305>
:family_name "Phrymaceae" ;
:genome_assembly_id "t34305.G002" ;
:genus_name "Erythranthe" ;
:phylum_name "Streptophyta" ;
:superkingdom_name "Eukaryota" .
<https://plantgarden.jp/en/list/t3747/gene/Lj0g3v0013599.1>
faldo:location [
faldo:begin [
faldo:position "125577831" ;
faldo:reference <https://plantgarden.jp/en/list/t34305/sequence/Lj3.0_chr0> ;
a faldo:ExactPosition, faldo:ReverseStrandPosition
] ;
faldo:end [
faldo:position "125578853" ;
faldo:reference <https://plantgarden.jp/en/list/t34305/sequence/Lj3.0_chr0> ;
a faldo:ExactPosition, faldo:ReverseStrandPosition
] ;
a faldo:Region
] ;
a obo:SO_0000704 .
<https://plantgarden.jp/en/seq/t34305/t34305.G002/cds/Lj0g3v0013599.1>
obo:BFO_0000050 <https://plantgarden.jp/en/list/t34305/gene/Lj0g3v0013599.1> ;
obo:RO_0002162 <http://identifiers.org/taxonomy/34305> ;
dc:identifier "Lj0g3v0242029.1" ;
a obo:SO_0000316 ;
rdfs:comment "" ;
:annotation_version "Lj3.0" .
<https://plantgarden.jp/en/seq/t34305/t34305.G002/pep/Lj0g3v0013599.1>
obo:RO_0001000 <https://plantgarden.jp/en/seq/t34305/t34305.G002/cds/Lj0g3v0013599.1> ;
dc:indentifier "Lj0g3v0242029.1" ;
sio:SIO_000558 <http://purl.uniprot.org/uniprot/A0A022RW76> ;
a obo:SO_0000104 ;
:classifiedWith obo:GO_0003735, obo:GO_0006412, obo:GO_0022625, <https://identifiers.org/kegg.orthology:K02885> .
@prefix : <https://plantgardden.jp/ns/> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix dc: <http://purl.org/dc/terms/> .
@prefix obo: <http://purl.obolibrary.org/obo/> .
@prefix faldo: <http://biohackathon.org/resource/faldo#> .
<https://plantgarden.jp/en/seq/t34305/all/Ljchlorog3v0000020> rdf:type obo:SO_0000704 ; # Gene
dc:identifier "Ljchlorog3v0000020" ;
rdfs:label "Ljchlorog3v0000020" ;
faldo:location [
rdf:type faldo:Region ;
faldo:begin [
faldo:position 519 ;
faldo:reference <https://plantgarden.jp/en/list/t34305/sequence/Lj3.0_chrC> ;
rdf:type faldo:ExactPosition ;
rdf:type faldo:ForwardStrandPosition
] ;
faldo:end [
faldo:position 1371 ;
faldo:reference <https://plantgarden.jp/en/list/t34305/sequence/> ;
rdf:type faldo:ExactPosition ;
rdf:type faldo:ForwardStrandPosition
]
] .
@prefix : <https://plantgardden.jp/ns/> .
@prefix rdf: <http://www.w3.org/1999/02/22-rdf-syntax-ns#> .
@prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> .
@prefix dc: <http://purl.org/dc/terms/> .
@prefix obo: <http://purl.obolibrary.org/obo/> .
@prefix faldo: <http://biohackathon.org/resource/faldo#> .
@prefix sio: <http://semanticscience.org/resource/> .
@prefix prov: <http://www.w3.org/ns/prov#> .
<https://plantgarden.jp/en/search/trait/t34305/t34305.T000001> rdf:type obo:SO_0000771 ; #QTL
dc:identifier "t34305.T000001" ;
rdfs:label "NA" ;
:species_id "t34305" ;
dc:references <http://doi.org/10.110.1007/s10265-011-0459-1111/tpj.12220> ;
:trait "ARA/P (acetylene reduction activity per plant)" ;
:analysis_method "QTL analysis" ;
:max_lod 5.56 ;
:p_value "NA" .
# Physical Map Location TODO:更新 Genome/Sequence
<https://plantgarden.jp/en/search/trait/t34305/t34305.T000001> faldo:location [
rdf:type faldo:Region ;
:nearest_marker1 <https://plantgarden.jp/en/list/t34305/marker/t34305.M000576.1> ;
:nearest_marker2 <https://plantgarden.jp/en/list/t34305/marker/t34305.M000451.1> ;
:genome_assembly_id "t34305.G002" ;
] .
# Linkage Map Location
<https://plantgarden.jp/en/search/trait/t34305/t34305.T000001> faldo:location [
rdf:type faldo:Position ;
faldo:position 68.3 ; #genetic_locus
faldo:reference <https://plantgarden.jp/en/search/trait/t34305#linkage-map> ;
] .
# Analysis/Population/LinkageMap
# Population
<https://plantgarden.jp/en/search/trait/t34305/t34305.T000001> :population <https://plantgarden.jp/en/search/trait/t34305/t34305.T000001#population> .
<https://plantgarden.jp/en/search/trait/t34305/t34305.T000001#population> rdf:type sio:SIO_001061 ; #Population
rdf:type :RIL ; #Population Type
rdfs:label "LjMG RIL population (Miyakojima MG- 20 x Gifu B-129)" . #Population Name
# Trait Annotation
<https://plantgarden.jp/en/search/trait/t34305/t34305.T000001> sio:has_annotation <https://plantgarden.jp/en/search/trait/t34305/t34305.T000001#manual> ;
rdf:type :TraitAnnotation ;
:assertion obo:ECO_0000218 ;
prov:wasGeneratedBy <https://plantgarden.jp#curation_activity> ;
:target <https://plantgarden.jp/en/search/trait/t34305/t34305.T000001> ;
:body "ARA/P (acetylene reduction activity per plant)" ;
prov:hadPrimarySource <http://doi.org/10.110.1007/s10265-011-0459-1111/tpj.12220> ;
:semanticTags obo:TO_0000183 ;
:category 6
- 植物ゲノムのgene/mRNA/CDS/exon/intron構造アノテーションが揺れているのでとりあえずgeneのみ対応
%perl scripts/make_ttl_gff3.pl FANhybrid_r1.2.genes.gff3
$VAR1 = {
'intron' => 110204,
'CDS' => 143958,
'gene' => 45377,
'exon' => 148259
};
%perl scripts/make_ttl_gff3.pl Glycine_max.Glycine_max_v2.1.42.chr.gff3
$VAR1 = {
'mRNA' => 87977,
'CDS' => 522339,
'pre_miRNA' => 78,
'RNase_MRP_RNA' => 2,
'ncRNA_gene' => 1237,
'five_prime_UTR' => 62642,
'three_prime_UTR' => 63724,
'snRNA' => 147,
'' => 56872,
'tRNA' => 427,
'rRNA' => 361,
'SRP_RNA' => 20,
'exon' => 523576,
'biological_region' => 2169,
'lnc_RNA' => 8,
'snoRNA' => 192,
'ncRNA' => 2,
'chromosome' => 20,
'gene' => 55589
};
%perl scripts/make_ttl_gff3.pl glyma.Lee.gnm1.ann1.6NZV.gene_models_main.gff3
$VAR1 = {
'three_prime_UTR' => 76908,
'CDS' => 437712,
'five_prime_UTR' => 89458,
'gene' => 47649,
'mRNA' => 71358,
'' => 3
};
%perl scripts/make_ttl_gff3.pl GWHAAEV00000000.gff
$VAR1 = {
'mRNA' => 58017,
'CDS' => 333842,
'rRNA_primary_transcript' => 8,
'' => 489,
'gene' => 52178,
'three_prime_UTR' => 32903,
'five_prime_UTR' => 34834,
'tRNA_primary_transcript' => 29,
'exon' => 345307
};
%perl scripts/make_ttl_gff3.pl Brapa_genome_v3.0_genes.gff3
$VAR1 = {
'gene' => 46250,
'mRNA' => 46250,
'CDS' => 221750
};