AlignDB::DeltaG - Calculate deltaG of polymer DNA sequences
-
Normal use
use AlignDB::DeltaG my $deltaG = AlignDB::DeltaG->new( temperature => 37, salt_conc => 1, ); my $seq = "TAACAAGCAATGAGATAGAGAAAGAAATATATCCA"; print "$seq deltaG: ", $deltaG->polymer_deltaG($seq), "\n";
-
Reset conditionss
use AlignDB::DeltaG; # default value: # temperature => 37, # salt_conc => 1, my $deltaG = AlignDB::DeltaG->new; $deltaG->temperature(30); $deltaG->salt_conc(0.1); $deltaG->BUILD; my $seq = "TAACAAGCAATGAGATAGAGAAAGAAATATATCCA"; print "$seq deltaG: ", $deltaG->polymer_deltaG($seq), "\n";
AlignDB::DeltaG
is a simple class to calculate deltaG of polymer DNA sequences using the NN model.
In the near future, it may be extanded to calculate oligonucleotide thermodynamics.
1. SantaLucia J, Jr. 2004. Annu Rev Biophys Biomol Struct;
2. SantaLucia J, Jr. 1998. Proc Natl Acad Sci U S A;
temperature
- default: 37.0 degree centigrade
salt_conc
- salt concentration, Default: 1 [Na+], in M. Should be above 0.05 M and below 1.1 M
deltaH
- enthalpy, isa HashRef
deltaS
- entropy (cal/K.mol), isa HashRef
deltaG
- free energy, isa HashRef
rebuild the object by the new temperature and/or salt_conc values
my $dG = $obj->polymer_deltaG($seq);
Calculate deltaG of a given sequence.
This method is the main calculating sub.
Qiang Wang <wang-q@outlook.com>
This software is copyright (c) 2008 by Qiang Wang.
This is free software; you can redistribute it and/or modify it under the same terms as the Perl 5 programming language system itself.