AlgoLab/bwt-lcp-parallel

Results change with each running when using multi-threads

DAyamaCTF opened this issue · 3 comments

DAyamaCTF commented

I tried this program, but results change with each running when using multi-threads.
The execution environment is as follows:

  • OS: Ubuntu 18.04.2 LTS
  • cpu cores : 8

I did an experiment for following data (test.fasta) using 8 threads.

Data (test.fasta)

>read1
GTCCGTACGTACTGCATGCAGTACTGGTCAGTCAGTCGTACGTACGTCG

Command

$ ./bwt_lcp test.fasta 8

Then, the following BWT strings was output for each execution. (decoded by ./decode_bwt )

GTTTTTCCCCGTTGTTTCAAAAACTTTCCCCAGA$CAGGGGGGGGGGACC
GTTTTTCCCCGTTGTTTCAAAAACTTTCCCCAGA$CAGGGGGGGGGGCAC

I think the first one is correct.

yp commented

Thanks for reporting this issue. We will look into it as soon as possible.

  • 👍1
yp commented

You actually uncovered a data race while computing segment boundaries. It should be fixed now. Please let us know if you encounter other issues.
Thanks again.

  • 👍1
DAyamaCTF commented

It's working as expected.
Thanks.