About this small project

what is strobemer? see https://github.com/ksahlin/strobemers

this project implement an c++ version of the strobemer s(n,k,w_min,w_max) with small difference (the window will not shrink at the end of sequence).

Features:

any n>1 is supported.
randstrobes is supported.
minstrobes is supported.
hybirdstrobes is supported.

there small benchmark were attached. (Ignore them if you don't care)

The implementation of strobemer

How to use the c++ implemention of strobemer ? See toy_example

first copy strobemer.h and strobemer.cpp into your project.
then write your code like :

#include "strobemer.h"

int main() {
     char seq[101]="ATGGGCAGAGTTTGACGTAGTCAATGCTTATGAACGAACGCTCCAATATGAATCAGCTCGTGATTTTTGCTGTAAAAATCGTAGCATACTGTTTGATAAA";
     //strobemer::init(3,13,13,20,strobemer_type::minstrobe); // n=3,k=13,w_min=13,w_max=20,type=minstrobe
     //strobemer::init(3,13,13,21,strobemer_type::hybridstrobe); // n=3,k=13,w_min=13,w_max=20,type=hybridstrobe
     strobemer::init(3,13,13,20,strobemer_type::randstrobe);  // n=3,k=13,w_min=13,w_max=20,type=randstrobe
     int number = 100-strobemer::strobmer_span()+1;
     strobemer * buff = new strobemer[number];
     strobemer::chop_strobemer(seq,100,buff);
     for(int i = 0 ; i< number ; i++ ){
         if(buff[i].valid)
             std::cout<<buff[i].to_string()<<'\n'; // or do whatever you want ...
     }
     delete [] buff;
     return 0;
}

then compile and link it like:

g++  -std=c++11 -c strobemer.cpp -o strobemer.o
g++  -std=c++11 example.cpp strobemer.o -o example

There benchmarks

the test date

random sequence with length=100,000 nt.
mutation rates are 0.01, 0.05 and 0.1.
random mutaion.
equal probability of sub/ins/del.
each test run 100 times.

benchmark_SIM-R-match-only

compare the match number of all kmer/strobemer.
compare k30, randstrobe(2,15,50) and minstrobe(2,15,50).

Results of the "average match of all kmers/strobemers (%) " for different error rates and different methods:

	0.01	0.05	0.1
Kmer(30)	74.6	22.5	4.7
minstrobe(2,15,15,50)	70.1	17.5	3.2
randstrobe(2,15,15,50)	70.1	17.5	3.2

benchmark_SIM-R-snp30

compare the match number of all kmer/strobemer snp markers.
assign one snp for each 1000bp ( total 99 snps for 100,000bp because I drop the snp at the sequence end ).
compare k30, randstrobe(2,15,50) and minstrobe(2,15,50).
for k30, one snp generate 30 kmer markers.
for strobemer(2,15,50), each snp generate 65 strobemer markers.

Results of the "average match number of all snp markers" for different error rates and different methods:

	0.01	0.05	0.1
Kmer(30)	2210	665	143
minstrobe(2,15,15,50)	4511	1100	208
randstrobe(2,15,15,50)	4502	1134	210

Results of the "#detected snp " for different error rates and different methods:

	0.01	0.05	0.1
Kmer(30)	94.5	55.5	18
minstrobe(2,15,15,50)	98	68.5	26.3
randstrobe(2,15,15,50)	99	92.3	52.3

benchmark_SIM-R-snp20

compare the match number of all kmer/strobemer snp markers.
assign one snp for each 1000bp ( total 99 snps for 100,000bp because I drop the snp at the sequence end ).
compare k20, k40, randstrobe(2,10,30) and minstrobe(2,10,30).
for K20, one snp generate 20 kmer markers.
for K40, one snp generate 40 kmer markers.
for strobemer(2,10,30), each snp generate 40 strobemer markers.