STAP v2: Sequence To Binding Affinity Prediction (version 2) Saurabh Sinha’s Lab <sinhas@illinois.edu> Initially created by Xin He Last modified on Oct. 17, 2013 Description The program makes use of a biophysically motivated computational model to analyze transcription factor (TF)-DNA binding data, such as ChIP-chip or ChIP-SEQ data. The program assumes that the measured affinity of a sequence to a TF (TF_exp) in some ChIP-chip or ChIP-SEQ experiment is determined by: 1) the number and strength of binding sites of TF_exp in this sequence; 2) the presence of other sites that may influence the binding affinities of the neighboring sites to TF_exp. Specifically, it takes as input a set of DNA sequences, their binding affinities to some TF as measured by experiments (TF_exp), and the position weight matrices (PWMs) of a set of TFs, including TF_exp. It will learn the relevant parameters of the biophysical model of TF-DNA interaction, including those of TF-DNA interaction and those of TF-TF cooperative interactions. The program can be used for several purposes: (1) Test if a given TF binding motif can predict the binding affinities of the sequences . It predicts the binding sites based on this motif, and computes the theoretical values of the binding affinities of the sequences. The predicted values will be compared with the observations to judge the success of the model. (2) When multiple motifs are given as inputs, the program assumes the first motif is the one of the experimetnal TF (TF_exp), and the rest are the motifs that may directly or indirectly interact with TF_exp (meaning that the neigboring sites of other factors can influence DNA binding of TF_exp). The program will learn which motifs are likely to interact with TF_exp and further learn which secondary-motif’s influence is likely to be (a) through long-range versus short-range interactions with the primary motif, (b) through synergistic or antagonistic interactions, and (c) through modulation of local DNA accessibility or direct interactions between TFs. (3) Once a biophysical model is learned, it can be applied to predict affinities of other sequences. This would be useful, for example, for analyzing sequences in a different organism. Installation The program needs GNU Scientific Library (GSL). If it is not installed in your system, go to: http://www.gnu.org/software/gsl/ Note that after installing GSL, you need to change the start-up script of your shell, e.g., .bash_profile or .profile at your home directory, which depends on your OS. Suppose the GSL installation directory is /raid/apps/gsl-1.8/lib (i.e., my_gsl_dir=/raid/apps/gsl-1.8/lib): LD_LIBRARY_PATH=/raid/apps/gsl-1.8/lib:$LD_LIBRARY_PATH export LD_LIBRARY_PATH After extracting the program, change the GSL directory in src/Makefile, e.g.: GSL_DIR = my_gsl_dir Then simply type: make Running the program Usage in general: ./seq2binding -s <seqFile> -d <dataFile> -m <motifFile> The program takes three arguments as input: seqFile: the FASTA format file of sequences. See examples/Nanog_top_500.fa. >chr1:136351629-136351631 136351630 -250 +250 >gtggtgatgcccaaccacagaattattttgttgctactttataactgtaattttgatcct >chr3:122137593-122137593 122137593 -250 +250 atttctagttccagtgactgggagactgaaacaagagagtcacttgagtacaggagtgca dataFile: the binding data of all sequences in the seqFile. The first column is the sequence id (must be the same as those used in seqFile, and in the same order), and the second column is the measured strength of binding. See examples/Nanog_top_500.txt. chr1:136351629-136351631 312 chr3:122137593-122137593 307 motifFile: the motifs of the TFs. It could contain multiple motifs. The header line consists of motif name, length and pseudocount (0.5 should be OK for most motifs). The first motif should be the one of TF_exp, and the rest are putative TFs that interact cooperatively with TF_exp. See examples/Nanog_Oct4.wtmx and examples/Nanog.wtmx. >Nanog 9 0.5 20 225 46 209 70 0 19 411 50 66 381 3 434 45 0 21 55 5 66 374 17 32 222 229 74 18 325 83 8 243 146 103 48 145 6 301 < Output: (1) Estimated parameters: binding parameter (how strongly the TF binds with its binding site); the interaction weight parameters between any pair of TFs (the order of motifs in the matrix follows the order defined in motifFile): greater than 1 if cooperative interaction, less than 1 antagonistic, 1 if no interaction. (2) Pearson correlation between predicted binding and observed binding. Examples: (1) Run with a single factor: test if the provided Nanog motif explains the binding of top 500 Nanog sequences in experiments: (under examples/ directory) ../src/seq2binding -m Nanog.wtmx -s Nanog_top_500.fa -d Nanog_top_500.txt (2) Run with multiple factors (TF_exp, and other factors): test if Nanog interacts cooperatively with Oct4 in the top 500 Nanog sequences: (under examples/ directory) ../src/seq2binding -m Nanog_Oct4.wtmx -s Nanog_top_500.fa -d Nanog_top_500.txt Advanced options -ts <testSeqFile> -td <testDataFile>: test the trained model in additional testing data. The format of testSeqFile and testDatafile is the same as seqFile and dataFile. -n <nExps>: the number of experiments being analyzed. The default value is 1, i.e. only one experiment (binding data of one TF) is analyzed. When analyzing binding data of multiple TFs, set nExps as the number of TFs. In this case, it is assumed that seqFile and dataFile contain the concantenation of data of multiple factors (assume the number of records of each TF is equal, thus no explicit delimiter is needed between data of different TFs). -co <coopOption>: the option of cooperative binding. 0 - no cooperativity at all; 1 - no self- cooperativity, but hetero-cooperativity; 2 - allow all cooperativities -io <interactionOption>: the option for modeling factor-factor interaction. 0 - binary; 1 - linear; 2 - periodic; 3 - normal distribution. -dt <d_max>: the maximum site-site distance if possible interaction happens (beyond which there will be no interaction) -cc <interactionWeightRange> : possible DNA-specific transcription factor-factor intercation. 1 - possible cooperative factor-factor interation; -1 - possible antagonistic factor-factor interaction; 11 - both. Different options cause the interaction weight parameters cast into different ranges. -oe <r_orientationEffect>: orientation effect if two interacting sites happen on different strands, suitable for all interaction modeling options. If two sides are in the same strands, there is no orientation effect, i.e., r_orientationEffect =1> -r <distanceRange>: maximum valid distance range in linear interaction mode. Outside the range, the site-site interaction starts to decline. By default, distance range is equal to 50. -se <spacingEffect>: spacing effect in the periodic interaction. The spacing effect is a constant term due to DNA looping (exponential of the average free energy of DNA looping). The other parameters associated with the periodic interaction mode are as follows: – T <period>. 10 is by default. – phi <r_phi>: phase angle in periodic model if two sites are in the same strand – phi0 <r_phi0>>: phase angle in periodic model if two sites are in the different strands -iv <PPInteractionDecayVariance> : Decay variance of DNA-specific TF-TF binding affinities in the normal distribution model. A protein-protein physical interaction represents the biological macromolecule as an elastic mass-and-spring network. Its force constant exhibites an exponential decay over the distance between a pair of interacting atoms. The force constant is defined as an exponential decay function of distance. By default, it is 25. -et <energyThr> : general energy threshold for each motif site (by default, it is 10). Or -llrt <strMotifSiteThr>: motif site thresholds separated by a punctuation mark (,). Each motif site threshold is set by the motif’s llr score when pval is closest to 0.05. Refer to utils/getMotifsLLRPValue.sh for calculating the motif site LLR threshold. -rr <n_RandStarts>: the number of simulation runs, each of which starts with random parameter inputs. -pm <paramModelOutFile>: print the learned parameter values in the file paramModelOutFile. The file format is as follows: maxBindingWts = 1.02727 1.45616 numOfInFactors=1 inFactorIntMat= 1 numOfOutFactors=1 outFactorIntMat= 1.147017 expRatios = 1.000000 -fstr <featureTrainMsgOutFile>: print the TF-DNA binding features on the training data set in the file featureTrainMsgOutFile -fste <featureTestMsgOutFile>: print the TF-DNA binding features on the test data set in the file featureTestMsgOutFile -p <trainPredictionOutFile>: print the predicted binding intensities (of the training sequences in seqFile) in the file trainPredictionOutFile. -tp <testPredictionOutFile>: print the predicted binding intensities (of the test sequences in testSeqFile) in the file testPredictionOutFile -pin <paramModelInFile> [-ot]: give the parameter-value input file which suggested initial values for model parameters. –ot is optional. For example, ../src/seq2binding -m Nanog_Oct4.wtmx -s Nanog_top_500.fa -d Nanog_top_500.txt -cc 1 -io 0 -co 1 -et 8 -pin paramModelInFile.txt -ot ignore the learning or training procedure and predict the binding affinity just based on given input parameter values. -isM1BWFixed -bw <initBindingWeight>: force the STAP to fix the primary TF binding weight as a constant of initBindingWeight, not as a free parameter, in each simulation iteration. There are other parameters that control the factor-factor interaction model. The file utils/run_pair.sh contains examples of using these parameters. In most cases, you probably do not need to set these parameters. Utilities In utils/ directory, some useful scripts are included. However, not all of them can be ready to execute in your system. Some of them are included only for the purpose of demonstrating the use of program. run_pair.sh: demonstrate the use of program (for analyzing cooperative interactions using binding data of two TFs). create_null_distr.sh: suppose we want to find cooperative factors of one TF (TF_exp). First run the program using TF_exp and the test motif, and obtain the correlation coefficient (CC) of the test motif. Then run this script to get the null distribution of the CC. The script will sample random motifs from a specified collection of motif, and calculate CC of the random motifs. shuffle_wtmx.pl: random shuffling of a motif, used by create_null_distr.sh. split_wtmx.pl: split a file of many PWMs into multiple files, each of which contains a single motif. getMotifsLLRPValue.sh: calculate the motif site LLR threshold based on its Pvalue.
UIUCSinhaLab/STAP
A biophysical model for analysis of transcription factor interaction and binding site arrangement from genome-wide binding data. http://www.ncbi.nlm.nih.gov/pubmed/19956545
C++