/cruzdb

python access to UCSC genomes database

Primary LanguagePython

cruzdb

The UCSC Genomes Database is a great resource for annoations, regulation and variation and all kinds of data for a growing number of taxa. This library aims to make utilizing that data simple so that we can do sophisticated analyses without resorting to awk-ful, error-prone manipulations. As motivation, here's an example of some of the capabilities:

>>> from cruzdb import Genome

>>> g = Genome(db="hg18")

>>> muc5b = g.refGene.filter_by(name2="MUC5B").first()
>>> muc5b
refGene(chr11:MUC5B:1200870-1239982)

>>> muc5b.strand
'+'

# the first 4 introns
>>> muc5b.introns[:4]
[(1200999, 1203486), (1203543, 1204010), (1204082, 1204420), (1204682, 1204836)]

# the first 4 exons.
>>> muc5b.exons[:4]
[(1200870, 1200999), (1203486, 1203543), (1204010, 1204082), (1204420, 1204682)]

# note that some of these are not coding because they are < cdsStart
>>> muc5b.cdsStart
1200929L

# the extent of the 5' utr.
>>> muc5b.utr5
(1200870L, 1200929L)

# we can get the (first 4) actual CDS's with:
>>> muc5b.cds[:4]
[(1200929L, 1200999), (1203486, 1203543), (1204010, 1204082), (1204420, 1204682)]

# the cds sequence from the UCSC DAS server as a list with one entry per cds
>>> muc5b.cds_sequence #doctest: +ELLIPSIS
['atgggtgccccgagcgcgtgccggacgctggtgttggctctggcggccatgctcgtggtgccgcaggcag', ...]

this can be repeated using knownGene annotations by changing 'refGene' to 'knownGene'. And, it can be done easily for a set of genes.

Code

Most of the per-row features are implemented in cruzdb/models.py in the Mixin class. If you want to add something to a feature (like the existing feature.utr5) add it here.

The tables are reflected using sqlalchemy and mapped in the __getattr__method of the Genome class in cruzdb/__init__.py

So a call like:

genome.knownGene

calls the __getattr__ method with the table arg set to 'knownGene' that table is then reflected and an object with parent classes of Mixin and sqlalchemy's declarative_base is returned.

Contributing

YES PLEASE!

To start coding, it is probably polite to grab your own copy of some of the UCSC tables so as not to overload the UCSC server. After setting up mysql, you can run this script to get your own set of commonly used tables.

Then the connection line above would be something like:

g = Genome(db="hg18", host="localhost", user="brentp")

If you have a feature you like to use/implement, open a ticket on github for discussion. Below are some ideas.

TODO