-
Navigate to the new flowcell data output.
-
git clone this repository
git clone https://github.com/jebard/fastq-to-treat.git -
Activate the python anaconda environment (testing on CCR 11-21-19)
source fastq-to-treat/bin/activate -
Edit the config.json file and cluster.json files
-
Ensure meta-data table contains all of the necessairy fields (TABBED-DELIMITED:
Sample gene offset tetracycline knock_down replicate Adapter_1 Adapter_2 path_to_treat_template ForwardFastqGZ ReverseFastqGZ
Example :
`A6_3B_alenaSM_2 A63B 25 FALSE alenaSM 2 GAAAACACCCATTTTTAGGAGG GGAGTTATAGAATAAGATCAAATAAG projects/academic/lread/gene-templates/A63B.fasta A6_3B_alenaSM_2_S20_R1_001.fastq.gz A6_3B_alenaSM_2_S20_R2_001.fastq.gz`
** NOTE EXACT HEADERS HAVE TO BE ENFORCED or key errors will be thrown during processing**
- Launch jobs
The pipeline will utilize CCR resource to parallel execution. OTU table and statisics about merge rate, filter rate, hit rate wiil be placed under table
The use of --latency-wait allows for SLURM to catch up writing the files and posting the file handles so Snakemake can see them.
`snakemake --latency-wait 120 -p -j 100 --cluster-config cluster.json --cluster "sbatch --qos nih"`
-
Pipeline should result in a treat.db file -- proceed with treat normalization process.
-
Copy over the resulting treat.db file onto your local machine, or a machine that can launch a treat web browser.
-
Run treat.exe --db server (or equivalent command found https://github.com/ubccr/treat)
To launch treat with updated DB Copy the new .database file into /lread/dbs
- Check treats status
systemctl status treat
- Stop the treat service
sudo systemctl stop treat
- Should show treat as stopped
sudo systemctl status treat
- Restart the treat service
sudo systemctl start treat
- NOTE: this will start treat up and will take some time to load.
- To monitor the service
sudo journalctl -f -u treat