ExTraMapper is a tool to find Exon and Transcript-level Mappings of a given pair of orthologous genes between two organisms using sequence conservation. The figure below shows the overall schematic description of ExTraMapper mapping the homologous transcript and exon-pairs between human and mouse genome.
ExTraMapper requires a set of preprocessed files to find the conservation scores. Examples to create these files are provided within the following folders
The users should run the extMpreprocess to generate the inputfiles within the above Preprocessed-Data folders. All the input files will be generated under preprocess/data folder. All the required executables and scripts are provided here. The extMpreprocess has 7 individual steps and should be run in the following manner
-
For help, type
./extMpreprocess help This script will download and preprocess the dataset required for exon-pair and transcript pair finding by ExTraMapper. Type ./extMpreprocess <config.conf> <step> to execute the script. Type ./extMpreprocess example to print a example config.conf file. This script will run seven (7) sequential steps to create the inputs for ExTraMapper program. Users can provide step numbers (1-7) or all in the <step> arugemt of this script. Short description of the individual scripts: Step 1: Download per organism specific files e.g. reference genomes, gene annotation files. Step 2: Will create genomedata archives with the genomes of org1 and org2 (Make sure to install genomedata package). Step 3: Pickle files for each homologous gene pair will be created. Step 4: Perform coordinate liftOver of exons with multiple mappings (This step requires bedtools and liftOver executables). Step 5-7: postprocessing the liftOver files. example: ./extMpreprocess config.human-mouse.conf all
bash export EXTRAMAPPER_DIR=/path/to/this/folder
$ python ExTraMapper.py -h
usage: ExTraMapper.py [-h] -m MAPPING -o1 ORG1 -o2 ORG2 -p ORTHOLOG
Check the help flag
optional arguments:
-h, --help show this help message and exit
-m MAPPING ExTraMapper Exon threshold value [e.g. 1]
-o1 ORG1 First organism name [e.g. human]
-o2 ORG2 Second organism name [e.g. mouse]
-p ORTHOLOG Orthologous gene pair [e.g. ENSG00000141510-ENSMUSG00000059552 OR all]$ python ExTraMapper.py -m 1 -o1 human -o2 mouse -p ENSG00000141510-ENSMUSG00000059552
Finding exon mappings for gene pair number 0 ENSG00000141510-ENSMUSG00000059552
*****************************************************************
Gene pair ID: ENSG00000141510-ENSMUSG00000059552
Information about each gene. Last two numbers are no of transcripts and exons
ENSG00000141510 chr17 7661779 7687538 - ENSG00000141510 TP53 protein_coding 27 49 gene
ENSMUSG00000059552 chr11 69580359 69591873 + ENSMUSG00000059552 Trp53 protein_coding 6 24 gene
Number of exons before and after duplicate removal according to coordinates
Org1 49 40
Org2 24 20
*****************************************************************
*****************************************************************
GCGCTGGGGACCTGTCCCTAGGGGGCAGATGAGACACTGATGGGCGTACTTAGAGATTTGCCATGAAGTGGGTTTGAAGAATGGAGCTGTGTGTGAAAT
Exon file type summaries for the first gene from: ENSG00000141510-ENSMUSG00000059552
0 exons with: No file exists
22 exons with: Only Mapped
0 exons with: Only nonintersecting
11 exons with: Only unmapped
15 exons with: Mapped and unmapped
0 exons with: Mapped and nonintersecting
1 exons with: Nonintersecting and unmapped
0 exons with: All three files
Exon file type summaries for the second gene from: ENSG00000141510-ENSMUSG00000059552
0 exons with: No file exists
14 exons with: Only Mapped
0 exons with: Only nonintersecting
3 exons with: Only unmapped
7 exons with: Mapped and unmapped
0 exons with: Mapped and nonintersecting
0 exons with: Nonintersecting and unmapped
0 exons with: All three files
Writing exon-level similarity scores into file:
/path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/exonLevelSimilarities-1.0.txt
Writing exon classes into file:
/path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/exonClasses-1.0.txt
For org1: Mapped exons= 17, Unmapped exons= 21, Nonintersecting exons= 1, OTHER= 10
For org2: Mapped exons= 13, Unmapped exons= 7, Nonintersecting exons= 0, OTHER= 4
*****************************************************************
*****************************************************************
Writing exon-level mappings into file:
/path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/exonLevelMappings-1.0.txt
Writing trascript-level similarity scores into file:
/path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/transcriptLevelSimilarities-1.0.txt
Writing transcript-level mappings into file:
/path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/transcriptLevelMappings-1.0.txt
Condition counter from the greedy transcript mapping stage:
5 pairs with Condition1: Unique winner pair
0 pairs with Condition2: Tie in one score, not in the other
0 pairs with Condition3: Tie in both scores but coding exon length diff breaks the tie
0 pairs with Condition4: Tie in both scores and coding exon length diff but overall exon length breaks the tie
1 pairs with Condition5: Tie in all the above but coding length (bp) diff breaks the tie
0 pairs with Condition6: Tie in all the above, just give up and report all
Writing UCSC browser bed output for org1 into file:
/path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/org1-ucsc-1.0.bed
Writing UCSC browser bed output for org2 into file:
/path/output/human-mouse/ENSG00000141510-ENSMUSG00000059552/org2-ucsc-1.0.bed
........
ExTraMapper ran successfully for 1 gene pairs between: human and mouse
*****************************************************************
$ tree ./output
./output
`-- human-mouse
`-- ENSG00000141510-ENSMUSG00000059552
|-- exonClasses-1.0.txt
|-- exonLevelMappings-1.0.txt
|-- exonLevelSimilarities-1.0.txt
|-- org1-ucsc-1.0.bed
|-- org2-ucsc-1.0.bed
|-- transcriptLevelMappings-1.0.txt
`-- transcriptLevelSimilarities-1.0.txtNote: The exonLevelMappings-1.0.txt & transcriptLevelMappings-1.0.txt file contains the mapped exon and transcript pairs from ENSG00000141510-ENSMUSG00000059552 orthologous gene-pair.
$ python ExTraMapper.py -h
usage: ExTraMapper.py [-h] -m MAPPING -o1 ORG1 -o2 ORG2 -p allRun extMsummarise script to generate a concatenated file will all the results. Run the script in the follwoing manner
$ ./extMsummarise help
Type ./extMsummarise <preprocess_folder> <extramapper_folder> <orthologous_genepair_list> <org1name> <org2name> <outputprefix>
preprocess_folder : Path to the preprocess folder generated by the extMpreproces script
extramapper_folder : Path to the output folder generated by ExTraMapper program
orthologous_genepair_list : A list of orthologous gene-pairs
org1name : org1 name e.g. human
org2name : org2 name e.g. mouse
outputprefix : output file prefix
example :
./extMsummarise ./preprocess ./output gene-pair.list human mouse extramapper-resultCheck the Result/Exon-Pairs and Result/Transcript-Pairs to download the precomputed ExTraMapper result for human-mouse and human-rhesus orthologous exon and transcript pairs.
ExTraMapper: Exon- and Transcript-level mappings for orthologous gene pairs.
Chakraborty A, Ay F, Davuluri RV. ExTraMapper: Exon- and Transcript-level mappings for orthologous gene pairs. Bioinformatics. 2021 May 20:btab393. doi: 10.1093/bioinformatics/btab393. Epub ahead of print. PMID: 34014317.
The data shown in the above paper was performed using Human & Mouse ENSMBL release 81 with python 2.7 code. The current update is with ENSMBL release 102 and python 3 or later version. To see the older code and data please change the Branch to ExTraMapper-python2v from master