SamGate
Create input files for MegaSat
If you haven't noticed already, SamGate is an anagram of MegaSat, which is a software program designed to automate the calling of microsatellite alleles from Illumina fastq sequences (see Zhan et al. 2017. Molecular Ecology Resources 17:247-256).
SamGate takes as input the output files of MsatCommander--a classic program for detecting microsatellite loci from DNA sequence data (Faircloth 2008. Molecular Ecology Resources 8:92-94).
Before using SamGate, you will need to run MsatCommander on a fasta file reference (most likely a whole genome sequence) from which you will be harvesting microsatellite loci. MsatCommander is available here: https://github.com/brantfaircloth/msatcommander. Msatcommander will then generate two files: an msats file and a primer file.
To use SamGate, open a terminal window and run the python script:
$ python /Users/John/Documents/SamGate/SamGate.py
The script will prompt you for three files:
- the original fasta file (.fa .fna .fasta)--the one that you used as input for Msat commander
- the msats file generated by msat commander
- the primer file generated by msat commander
The result is a MegaSat formated file with the primers, motif and flanking regions for each locus:
Locus-Name no_tail_left Rev_Comp_of_no_tail_Right ThreeFlank FiveFlank Repeat 46 ACCAACCTCAGTCATCAGGC CATCTGCTTCCTGACTCCCA ATTATTAAACTCAC AGTATTGGTTCTGTTTTCATGTTTAGACGCTTCTCTTGATTTGTAA ATC
Note: sometimes it is useful to concatenate MsatCommander output files before running SamGate. If you do this you will need to remove all header lines before hand... in fact, I recommend removing all header and subheader lines before running SamGate, regardless.
Note: this script was written to work with the MsatCommander version for mac osx. If you are running on a different platform your output files might have different column numbers, or so I am told. This is easy to fix in the python script. Comment lines will direct you to the indices that you will need to change to conform the script to the column organization of your output.