WFA
Important Notice. WFA2-lib has replaced the initial WFA version. We strongly recommend using WFA2-lib as it offers many more features, is more robust, and is actively being developed. This repository is left for academic and research purposes as its source code is simpler to understand and modify.
1. INTRODUCTION
1.1 What is WFA?
The wavefront alignment (WFA) algorithm is an exact gap-affine algorithm that takes advantage of homologous regions between the sequences to accelerate the alignment process. As opposed to traditional dynamic programming algorithms that run in quadratic time, the WFA runs in time O(ns), proportional to the read length n and the alignment score s, using O(s^2) memory. Moreover, the WFA exhibits simple data dependencies that can be easily vectorized, even by the automatic features of modern compilers, for different architectures, without the need to adapt the code.
This library implements the WFA and the WFA-Adapt algorithms for gap-affine penalties. It also provides support functions to display and verify the results. Moreover, it implements a benchmarking tool that evaluates the performance of these two algorithms, together with other high-performance alignment methods (checkout branch benchmark). The library can be executed through the benchmarking tool for evaluation purposes or can be integrated into your code by calling the WFA functions.
If you are interested in benchmarking WFA, and other algorithms implemented or integrated into the WFA library, checkout branch benchmark.
1.2 Getting started
Note: We recommend using the GCC compiler
Git clone and compile
$> git clone https://github.com/smarco/WFA.git WFA
$> cd WFA
$> make clean all
3. PROGRAMMING WITH WFA
Inside the folder tools/examples/ the user can find two simples examples of how to program using the WFA library. These examples illustrate how to integrate the WFA code into any tool.
3.1 Simple WFA example
This simple example illustrates how to align two sequences using the gap-affine WFA algorithm. First, we need to include the WFA alignment module.
#include "gap_affine/affine_wavefront_align.h"Then, we prepare the text, pattern, penalties, and the memory-managed (MM) allocator. Note that the affine_penalties is configured in terms of penalties. For that reason, mismatch, gap-opening, and gap-extension are supposed to be positive values.
// Patter & Text
char* pattern = "TCTTTACTCGCGCGTTGGAGAAATACAATAGT";
char* text = "TCTATACTGCGCGTTTGGAGAAATAAAATAGT";
// Allocate MM
mm_allocator_t* const mm_allocator = mm_allocator_new(BUFFER_SIZE_8M);
// Set penalties
affine_penalties_t affine_penalties = {
.match = 0,
.mismatch = 4,
.gap_opening = 6,
.gap_extension = 2,
};Afterwards, we initialize the affine_wavefronts object and align the pattern against the text using the configured penalties.
// Init Affine-WFA
affine_wavefronts_t* affine_wavefronts = affine_wavefronts_new_complete(
strlen(pattern),strlen(text),&affine_penalties,NULL,mm_allocator);
// Align
affine_wavefronts_align(
affine_wavefronts,pattern,strlen(pattern),text,strlen(text));Finally, we can display the results of the alignment process. For example, the alignment score and the alignment CIGAR. For this purpose, the function edit_cigar_score_gap_affine computes the CIGAR score, and the function edit_cigar_print_pretty prints pretty the CIGAR.
// Display alignment
const int score = edit_cigar_score_gap_affine(
&affine_wavefronts->edit_cigar,&affine_penalties);
fprintf(stderr," PATTERN %s\n",pattern);
fprintf(stderr," TEXT %s\n",text);
fprintf(stderr," SCORE COMPUTED %d\t",score);
edit_cigar_print_pretty(stderr,
pattern,strlen(pattern),text,strlen(text),
&affine_wavefronts->edit_cigar,mm_allocator);
// Free
affine_wavefronts_delete(affine_wavefronts);
mm_allocator_delete(mm_allocator);Compile and run:
$> gcc -O3 -I../.. -L../../build wfa_basic.c -o wfa_basic -lwfa
$> ./wfa_basic
3.2 WFA-Adaptive example
This example shows how to use the adaptive version of the WFA (i.e., WFA-Adaptive) to further improve the performance of the WFA algorithm by discarding alignment paths that are unlikely to reach the optimal solution. This example is very similar to the previous one. We only have to include the parameters minimum-wavefront-length and maximum-difference-distance.
const int min_wavefront_length = 10;
const int max_distance_threshold = 50;
// Init Affine-WFA
affine_wavefronts_t* affine_wavefronts = affine_wavefronts_new_reduced(
strlen(pattern),strlen(text),&affine_penalties,
min_wavefront_length,max_distance_threshold,NULL,mm_allocator);
// Align
affine_wavefronts_align(
affine_wavefronts,pattern,strlen(pattern),text,strlen(text));
In this example, we show how to access the individual elements of the CIGAR (i.e., 'M','X','I', and 'D') encoded using plain 8-bit ASCII.
// Count mismatches, deletions, and insertions
int i, misms=0, ins=0, del=0;
edit_cigar_t* const edit_cigar = &affine_wavefronts->edit_cigar;
for (i=edit_cigar->begin_offset;i<edit_cigar->end_offset;++i) {
switch (edit_cigar->operations[i]) {
case 'M': break;
case 'X': ++misms; break;
case 'D': ++del; break;
case 'I': ++ins; break;
}
}
fprintf(stderr,
"Alignment contains %d mismatches, %d insertions, "
"and %d deletions\n",misms,ins,del);Compile and run:
$> gcc -O3 -I../.. wfa_adapt.c ../../build/libwfa.a -o wfa_adapt
$> ./wfa_basic
3.3 Aligning sequences longer than 65.536 bases
By default, the WFA uses 16-bit integers to represent the alignment wavefronts. For that reason, the maximum sequence length allowed is 2^16. If you want to align longer sequences, you must adjust the definitions on gap_affine/affine_wavefront.h and select AFFINE_WAVEFRONT_W32.
/*
* Offset size
*/
//#define AFFINE_WAVEFRONT_W8
//#define AFFINE_WAVEFRONT_W16
#define AFFINE_WAVEFRONT_W32
4. BENCHMARKING. COMMAND-LINE AND OPTIONS
4.1 Introduction to benchmarking WFA. Simple tests
The WFA includes the benchmarking tool align-benchmark to test and compare the performance of several pairwise alignment implementations, including the WFA and WFA-Adapt. This tool takes as input a dataset containing pairs of sequences (i.e., pattern and text) to align. Patterns are preceded by the '>' symbol and texts by the '<' symbol. Example:
>ATTGGAAAATAGGATTGGGGTTTGTTTATATTTGGGTTGAGGGATGTCCCACCTTCGTCGTCCTTACGTTTCCGGAAGGGAGTGGTTAGCTCGAAGCCCA
<GATTGGAAAATAGGATGGGGTTTGTTTATATTTGGGTTGAGGGATGTCCCACCTTGTCGTCCTTACGTTTCCGGAAGGGAGTGGTTGCTCGAAGCCCA
>CCGTAGAGTTAGACACTCGACCGTGGTGAATCCGCGACCACCGCTTTGACGGGCGCTCTACGGTATCCCGCGATTTGTGTACGTGAAGCAGTGATTAAAC
<CCTAGAGTTAGACACTCGACCGTGGTGAATCCGCGATCTACCGCTTTGACGGGCGCTCTACGGTATCCCGCGATTTGTGTACGTGAAGCGAGTGATTAAAC
[...]
You can either generate a custom dataset of your own, or use the generate-dataset tool to generate a random dataset. For example, the following command generates a dataset named 'sample.dataset.seq' of 5M pairs of 100 bases with an alignment error of 5% (i.e., 5 mismatches, insertions or deletions per alignment).
$> ./bin/generate_dataset -n 5000000 -l 100 -e 0.05 -o sample.dataset.seq
Once you have the dataset ready, you can run the align-benchmark tool to benchmark the performance of a specific pairwise alignment method. For example, the WFA algorithm:
$> ./bin/align_benchmark -i sample.dataset.seq -a gap-affine-wfa
...processed 10000 reads (benchmark=125804.398 reads/s;alignment=188049.469 reads/s)
...processed 20000 reads (benchmark=117722.406 reads/s;alignment=180925.031 reads/s)
[...]
...processed 5000000 reads (benchmark=113844.039 reads/s;alignment=177325.281 reads/s)
[Benchmark]
=> Total.reads 5000000
=> Time.Benchmark 43.92 s ( 1 call, 43.92 s/call {min43.92s,Max43.92s})
=> Time.Alignment 28.20 s ( 64.20 %) ( 5 Mcalls, 5.64 us/call {min438ns,Max47.05ms})
The align-benchmark tool will finish and report overall benchmark time (including reading the input, setup, checking, etc.) and the time taken by the algorithm (i.e., Time.Alignment). If you want to measure the accuracy of the alignment method, you can add the option --check and all the alignments will be verified.
$> ./bin/align_benchmark -i sample.dataset.seq -a gap-affine-wfa --check
...processed 10000 reads (benchmark=14596.232 reads/s;alignment=201373.984 reads/s)
...processed 20000 reads (benchmark=13807.268 reads/s;alignment=194224.922 reads/s)
[...]
...processed 5000000 reads (benchmark=10625.568 reads/s;alignment=131371.703 reads/s)
[Benchmark]
=> Total.reads 5000000
=> Time.Benchmark 7.84 m ( 1 call, 470.56 s/call {min470.56s,Max470.56s})
=> Time.Alignment 28.06 s ( 5.9 %) ( 5 Mcalls, 5.61 us/call {min424ns,Max73.61ms})
[Accuracy]
=> Alignments.Correct 5.00 Malg (100.00 %) (samples=5M{mean1.00,min1.00,Max1.00,Var0.00,StdDev0.00)}
=> Score.Correct 5.00 Malg (100.00 %) (samples=5M{mean1.00,min1.00,Max1.00,Var0.00,StdDev0.00)}
=> Score.Total 147.01 Mscore uds. (samples=5M{mean29.40,min0.00,Max40.00,Var37.00,StdDev6.00)}
=> Score.Diff 0.00 score uds. ( 0.00 %) (samples=0,--n/a--)}
=> CIGAR.Correct 0.00 alg ( 0.00 %) (samples=0,--n/a--)}
=> CIGAR.Matches 484.76 Mbases ( 96.95 %) (samples=484M{mean1.00,min1.00,Max1.00,Var0.00,StdDev0.00)}
=> CIGAR.Mismatches 7.77 Mbases ( 1.55 %) (samples=7M{mean1.00,min1.00,Max1.00,Var0.00,StdDev0.00)}
=> CIGAR.Insertions 7.47 Mbases ( 1.49 %) (samples=7M{mean1.00,min1.00,Max1.00,Var0.00,StdDev0.00)}
=> CIGAR.Deletions 7.47 Mbases ( 1.49 %) (samples=7M{mean1.00,min1.00,Max1.00,Var0.00,StdDev0.00)}
Using the --check option, the tool will report Alignments.Correct (i.e., total alignments that are correct, not necessarily optimal), and Score.Correct (i.e., total alignments that have the optimal score). Note that the overall benchmark time will increase due to the overhead introduced by the checking routine, however the Time.Alignment should remain the same.
4.2 Generate-dataset tool (Command-line and Options)
--output|o <File>
Filename/Path to the output dataset.
--num-patterns|n <Integer>
Total number of pairs pattern-text to generate.
--length|l <Integer>
Total length of the pattern.
--error|e <Float>
Total error-rate between the pattern and the text (allowing single-base mismatches,
insertions and deletions). This parameter may modify the final length of the text.
--help|h
Outputs a succinct manual for the tool.
4.3 Align-benchmark tool (Command-line and Options)
Summary of algorithms/methods implemented within the benchmarking tool. If you are interested
in benchmarking WFA with other algorithms implemented or integrated into the WFA library,
checkout branch benchmark.
| Algorithm Name | Code-name | Distance Model | Output | Implementation | Extra Parameters |
|---|---|---|---|---|---|
| DP Edit | edit-dp | Edit-distace | Alignment | WFA | |
| DP Edit Banded | edit-dp-banded | Edit-distace | Alignment | WFA | --bandwidth |
| DP Gap-lineal | gap-lineal-nw | Gap-lineal | Alignment | WFA | |
| DP Gap-affine | gap-affine-swg | Gap-affine | Alignment | WFA | |
| DP Gap-affine Banded | gap-affine-swg-banded | Gap-affine | Alignment | WFA | --bandwidth |
| WFA Gap-affine | gap-affine-wfa | Gap-affine | Alignment | WFA | |
| WFA Gap-affine Adaptive | gap-affine-wfa-adaptive | Gap-affine | Alignment | WFA | --minimum-wavefront-length / --maximum-difference-distance |
- Input
--algorithm|a <algorithm-code-name>
Selects pair-wise alignment algorithm/implementation.
--input|i <File>
Filename/path to the input SEQ file. That is, file containing the sequence pairs to
align. Sequences are stored one per line, grouped by pairs where the pattern is
preceded by '>' and text by '<'.
- Penalties
--lineal-penalties|p M,X,I,D
Selects gap-lineal penalties for those alignment algorithms that use this penalty model.
Example: --lineal-penalties="-1,1,2,2"
--affine-penalties|g M,X,O,E
Selects gap-affine penalties for those alignment algorithms that use this penalty model.
Example: --affine-penalties="-1,4,2,6"
- Specifics
--bandwidth <INT>
Selects the bandwidth size for those algorithms that use bandwidth strategy.
--minimum-wavefront-length <INT>
Selects the minimum wavefront length to trigger the WFA-Adapt reduction method.
--maximum-difference-distance <INT>
Selects the maximum difference distance for the WFA-Adapt reduction method.
- Misc
--progress|P <integer>
Set the progress message periodicity.
--check|c 'correct'|'score'|'alignment'
Activates the verification of the alignment results.
--check-distance 'edit'|'gap-lineal'|'gap-affine'
Select the alignment-model to use for verification of the results.
--check-bandwidth <INT>
Sets a bandwidth for the simple verification functions.
--help|h
Outputs a succinct manual for the tool.
5. AUTHORS
Santiago Marco-Sola - santiagomsola@gmail.com
6. REPORTING BUGS
Feedback and bug reporting it's highly appreciated. Please report any issue or suggestion on github, or by email to the main developer (santiagomsola@gmail.com).
7. LICENSE
WFA is distributed under MIT licence.
8. CITATION
Santiago Marco-Sola, Juan Carlos Moure, Miquel Moreto, Antonio Espinosa. "Fast gap-affine pairwise alignment using the wavefront algorithm." Bioinformatics, 2020.