dna-codec.py <input> <args>| Flag | Description | Default |
|---|---|---|
| --encode | Encode | Yes |
| --columns: | Split result into columns | No / 0 |
| --decode | Decode | No |
--codec:<codec> |
Which encoder to use? | utf_8 |
| --string | Input a string | Yes |
| --file | Input a file | No |
| --raw | Raw input & output | No |
| --strict | Don't skip bad data | No |
| --help | Display some help | No |
Encode a string:
dna-codec.py "Hello, world!" --encode
Decode a string:
dna-codec.py CCCACGGACGCCAGAACACTCGACCGTCCGCC --decode
Decode a file:
dna-codec.py dna.txt --decode --file
Encode a binary file:
dna-codec.py rosie.jxl --encode --file --raw
Decode a string with a specific codec:
dna-codec.py "Hello, world!" --decode --codec:utf_16
Encode a file and store the output:
dna-codec.py data.txt --encode --file > output.txt
CGAGCTGCAGAACCCTCGTTCGTACGCGCGCTCGACCGTGCGCTAGAACGCACGCCAGAACACTCTAGCGTTCGTTCTCA