blast-galley

Precooked BLAST-related recipes, scripts and utilities

Introduction

In the blast-galley, I collect a mishmash of scripts and utilities for easy digestion of the NCBI Blast+ suite.

These tools were developed for my own use, but I've tried to make them self-contained (all have --help) so they may be of use to others.

Prerequisites

Several tools make use of GNU awk (gawk), which is available in every Linux distribution. Recent Debian/Ubuntu versions install mawk rather than gawk by default, so you may need to apt install gawk.

zblast

zblast is a very thin wrapper around the blast command. I use it because I keep forgetting the options that do what I want, while blastn -help is an oxymoron. For that same reason I maintain a Blast+ commmand-line reference

$ zblast "ATGAGCAT"         # default blast query against `nt` for given sequence
$ zblast queries.fasta      # same but reading subject(s) from file queries.fasta
$ echo "ATGAGCAT" | zblast  # same but reading subject from stdin
$ zblast -b "-perc_identity 99 -evalue 0.01"  ...  # pass options to blast

blastdb-get

blastdb-get retrieves sequences or metadata from a BLAST database, using sequence identifiers such as accession to identify the entry.

$ blastdb-get 'X74108.1'
>gi|395160|emb|X74108.1| V.cholerae gene for heat-stable enterotoxin, partial
TTATTATTTTCTTCAATCGCATTTAGCCAAACAGTAGAAAACAATACAAAAACAGTGCAGCAACCACAACAAATTGAAAG
CAAGGTAAATATTAAAAAACTAAGTGAAAATGAAGAATGCCCATTTATAAAACAAGTCGATGAAAATGGAAATCTCATTG

By default blastdb-get returns sequences in FASTA format, but it can also output tabular metadata and/or sequence data.

$ blastdb-get --header --table "aTls" EU545988.1 JF260983.1
Accession       TaxID           Length  Sequence data
EU545988.1      Zika virus      10272   ATGAAAAACCCCAAAGAAGAAATCCGGAGGATCC...
JF260983.1      Dengue virus    10176   ATGAATAACCAACGGAAAAAGGCGAGAAACACGC...

blastdb-find

Whereas blastdb-get retrieves sequences by identifier only, blastdb-find can also grep through sequence titles or select by taxonomy ID. By default it returns a list, but it can also produce the sequences in FASTA format.

$ blastdb-find -t 64320 -t 12637 'polyprotein .*complete cds'
gb|EU545988.1|  EU545988.1      64320   10272   Zika virus polyprotein gene, complete cds
gb|DQ859059.1|  DQ859059.1      64320   10254   Zika virus strain MR 766 polyprotein gene, complete cds
gb|JF260983.1|  JF260983.1      12637   10176   Dengue virus strain EEB-17 polyprotein gene, complete cds

Though blastdb-find can do a superset of what blastdb-get can do, it needs to maintain a cache of metadata per BLAST database. For 'key-based' queries, blastdb-get is generally faster, simpler, and more configurable.

gene-cutter

gene-cutter excises from one or more sequences the segment(s) which match a given template, such as a known gene sequence. It can operate on FASTA files or against sequences in a BLAST database.

The sequences being searched through should ideally consist of as few contigs as possible, as gene-cutter won't detect matches that straddle contigs. When matches break across contigs, mapping reads is the alternative. I've implemented that in mappet. In practice though, if gene-cutter gives a result, then it is both quick and accurate.

gene-cutter could be extended to work around fragmented matches, for instance by lowering the query coverage threshold so as to find subjects whose start or end is overlapped by the query, then stitching these together. Alternatively, we could use exonerate with affine:overlap model. The point of blast-galley however was to use only BLAST - with the added advantage that gene-cutter can be used against any BLAST database.

The gene-cutter script is self-contained; use -h, --help for documentation.

blast-in-silico-pcr

blast-in-silico-pcr is a bash script which tests pairs of PCR primers against a local BLAST database and returns the fragments selected by the primers.

The online in-silico PCR services at EHU and NCBI do the same thing and may do a better job. This script was intended as a quick shot at doing isPCR using only BLAST commands.

The script is self-contained; the usual -h, --help gives documentation.

taxo

taxo is a command line utility to search or browse a local copy of the NCBI taxonomy database. taxo has moved to https://github.com/zwets/taxo.

Miscellaneous

Why the name "blast-galley"?

Because it has a nice piratey ring. Pirates must be revered for the well-established fact that their presence attenuates global warming.

License

This program is free software: you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation, either version 3 of the License, or (at your option) any later version.

This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details.

You should have received a copy of the GNU General Public License along with this program. If not, see http://www.gnu.org/licenses/.

zwets/blast-galley