Astrodynamic/DNA_Analazer-Algorithms-for-working-with-text-in-CPP

This project implements substring search and sequence alignment algorithms for molecular sequences analysis. It includes the Rabin-Karp algorithm for substring search and the Needleman-Wunsch algorithm for sequence alignment. Developed in C++17, the code follows Google Style and includes a Makefile for building and testing the program.

Text Algorithms in CPP

Text Algorithms is a C++ project that implements substring search and sequence alignment algorithms. This project can be useful for bioinformatics and other full-text search tasks.

Dependencies

The project requires the following dependencies:

• CMake >= 3.15
• C++17-compatible compiler

Build

To build the project, follow these steps:

1. Clone the repository:

git clone https://github.com/your-username/TextAlgorithms.git

2. Navigate to the project directory:

cd TextAlgorithms

3. Run the following commands:

cmake -S . -B ./build
cmake --build ./build

Usage

Substring Search

The project implements the Rabin-Karp algorithm for substring search. To use it, include the SubstringSearch.h header and call the rabinKarp function with the haystack and needle strings:

#include "SubstringSearch.h"

// ...

std::string haystack = "Madam, I'm Adam";
std::string needle = "am";
std::vector<int> matches = rabinKarp(haystack, needle);
// matches contains the positions of the needle occurrences in the haystack

Sequence Alignment

The project implements the Needleman-Wunsch algorithm for sequence alignment. To use it, include the SequenceAlignment.h header and call the needlemanWunsch function with the two sequences and the similarity matrix:

#include "SequenceAlignment.h"

// ...

std::string seq1 = "GGGCGACACTCCACCATAGA";
std::string seq2 = "GGCGACACCCACCATACAT";
std::vector<std::string> alignment = needlemanWunsch(seq1, seq2, similarityMatrix);
// alignment contains the two sequences aligned with gaps

Examples

Substring Search

Find all occurrences of the string "AAGCCTCTCAAT" in the HIV virus sequence:

#include "SubstringSearch.h"
#include <fstream>
#include <iostream>

int main() {
  std::ifstream file("HIV.txt");
  std::string haystack((std::istreambuf_iterator<char>(file)), std::istreambuf_iterator<char>());
  std::string needle = "AAGCCTCTCAAT";
  std::vector<int> matches = rabinKarp(haystack, needle);
  for (int match : matches) {
    std::cout << "Match at position " << match << std::endl;
  }
  return 0;
}

Sequence Alignment

Align two DNA sequences using a similarity matrix:

#include "SequenceAlignment.h"
#include <iostream>

int main() {
  std::string seq1 = "GGGCGACACTCCACCATAGA";
  std::string seq2 = "GGCGACACCCACCATACAT";
  std::vector<std::string> alignment = needlemanWunsch(seq1, seq2, similarityMatrix);
  std::cout << alignment[0] << std::endl << alignment[1] << std::endl;
  return 0;
}

Matching regular expressions

The program checks whether a sequence over the alphabet {A, C, G, T} matches a regular expression.
The input of the program is a file with two lines. The first line contains the sequence to be checked for a match. The second line contains a pattern that includes characters from the alphabet and the following characters:

• . -- matches any single character from the alphabet;
• ? -- matches any single character from the alphabet or the absence of a character;
• + -- matches zero or more repetitions of the previous element;
• * -- matches any sequence of characters from the alphabet or the absence of characters.

The output of the program is True/False - whether the given sequence matches the pattern.

Example input:

GGCGACACCCACCATACAT
G?G*AC+A*A.

Example output:

True

K-similar strings

Strings s1 and s2 are k-similar (for some non-negative integer k) if it is possible to swap two letters in s1 exactly k times so that the resulting string is equal to s2.

The program checks k-similarity of two sequences over the alphabet {A, C, G, T}.
The input of the program is a file with two lines. The output of the program is the smallest k for which s1 and s2 are k-similar. If the strings are not anagrams, print an error message.

Example input:

GGCGACACC
AGCCGCGAC

Example output:

3

Minimum Window Substring

A program for finding the minimum window substring for a sequence over the alphabet {A, C, G, T}. The input to the program is a file containing two lines: s and t. A window substring of string s is a substring that contains all characters present in string t (including duplicates). The output of the program is the minimum length window substring. If there is no window substring, return an empty string.

Example input:

GGCGACACCCACCATACAT
TGT

Example output:

GACACCCACCATACAT

License

This project is licensed under the terms of the MIT license. See LICENSE for more information.