ERROR: '+' expected

[spw6422]

Hello. I keep getting the same error when running my RNA-seq data with fastp. The error implies that there is a '+' missing, but I don't see that in my fastq file. Please help.

Here is an example:

Command:
fastp --in1 R2_FKRN240086271-1A_2253CMLT4_L7_1.fq --out1 fastp_R2_1_trimmed.fq --in2 R2_FKRN240086271-1A_2253CMLT4_L7_2.fq --out2 fastp_R2_2_trimmed.fq

Error message:
Expected '+', got @LH00281:101:2253CMLT4:7:1153:17937:24071 2:N:0:GAAGACTAGC+TAGGAAGAGC
ERROR: '+' expected

I found the line in the fastq file where this error message is pointing to, and don't see any '+' missing:

[sfchen]

 Could you please upload a piece of your data so that I can reproduce this issue?   ------------------ Original ------------------ From: ***@***.***>; Date:  Wed, Jun 5, 2024 03:56 PM To: ***@***.***>; Cc: ***@***.***>; Subject:  [OpenGene/fastp] ERROR: '+' expected (Issue #565)   Hello. I keep getting the same error when running my RNA-seq data with fastp. The error implies that there is a '+' missing, but I don't see that in my fastq file. Please help. Here is an example: Command: fastp --in1 R2_FKRN240086271-1A_2253CMLT4_L7_1.fq --out1 fastp_R2_1_trimmed.fq --in2 R2_FKRN240086271-1A_2253CMLT4_L7_2.fq --out2 fastp_R2_2_trimmed.fq Error message: Expected '+', got @LH00281:101:2253CMLT4:7:1153:17937:24071 2:N:0:GAAGACTAGC+TAGGAAGAGC ERROR: '+' expected I found the line in the fastq file where this error message is pointing to, and don't see any '+' missing: Screenshot.2024-06-05.at.9.53.46.AM.png (view on web) — Reply to this email directly, view it on GitHub, or unsubscribe. You are receiving this because you are subscribed to this thread.Message ID: ***@***.***>

[spw6422]

I uploaded here 1M reads each of my forward and reverse files: https://1drv.ms/f/s!AlHK-h6IM1EWl-o0nQvUh8iCeZ5VYA?e=AF7xpe

I ran the following command:
fastp --in1 R2_F_1M.fq --out1 fastp_R2_1_trimmed.fq --in2 R2_R_1M.fq --out2 fastp_R2_2_trimmed.f

And got the following message:
Expected '+', got TCTTCGCCGACCTTCGCCGGCCTCAGCGCCACCGGGCGCAGCAGGAAAGACGGCACGTGGTCGCCCAGTCCAATGACGGGCGGCCCATCGTCTTCATGATGGCGCGGGCGGCGCTCACGACGGTCTGCGACAGGCGCCCCGGCCGGCGCC
ERROR: '+' expected

Not sure if this information is helpful: I am using a MacBook Pro with Apple M3 Pro chip.

[spw6422]

I just wanted to provide an update that I ran the exact same code using the exact same data, but on my institution's clusters (instead of my personal MacBook), and it worked perfectly.

[sfchen]

I checked your data, seems that the file R2_R_1M.fq is with bad format

@LH00281:101:2253CMLT4:7:1105:33021:5553 2:N:0:GAAGACTAGC+TAGGAAGAGC
TGCTACTATTGCTATCGCAGCTCTTTCTTCATGTGCAATGACCGTACCTGTGGCTGCTACGAGCAACCCAATCGGCAGTAAAGTAGGCACTTCCACCGGTTCCGGTTTTTTGGGAGTTCTTATCTTCTCGCCTGATACCGGCATTCAACA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@LH00281:101:2253CMLT4:7:1105:33377:5553 2:N:0:GIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@LH00281:101:2253CMLT4:7:1167:24751:12668 1:N:0:GAAGACTAGC+TAGGAAGAGC
TCTTCGCCGACCTTCGCCGGCCTCAGCGCCACCGGGCGCAGCAGGAAAGACGGCACGTGGTCGCCCAGTCCAATGACGGGCGGCCCATCGTCTTCATGATGGCGCGGGCGGCGCTCACGACGGTCTGCGACAGGCGCCCCGGCCGGCGCC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IIII-IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

[sfchen]

and the two files have different line numbers:

wc -l *.fq                
 4000000 R2_F_1M.fq
 3999297 R2_R_1M.fq