max_paths_from_root

[warthmann]

Hello,
I have abra2 integrated in a snakemake workflow for variant calling and it usually does a great job. With my current dataset on Maniok esculenta, however, Abra2 exits with error(s). Attached a screenshot shows tail -n 15 of 3 log files. Its a bunch of bam files in 3 different sample-sets mapped against the same reference genome. "resistant", "susceptible", and "all_samples", where "all_samples" is a combination of the other two

"susceptible": abra2 finished and exited cleanly

"resistant": abra2 exits with

TOO_MANY_PATHS_FROM_ROOT: NC_035164.1_3550000_3550400 - ATTCTAATGCCTATTCT
TOO_MANY_PATHS_FROM_ROOT: NC_035164.1_3550000_3550400 - CTTATCGGCCATCAAAAGCAT

all_samples: abra2 exits with
INFO Thu Aug 12 21:27:26 CEST 2021 PROCESS_REGION_MSECS: NC_035170.1_25785600_25786000 478 26 24 0
java: src/main/c/sparsehash/internal/densehashtable.h:930: std::pair<google::dense_hashtable_iterator<V, K, HF, ExK, SetK, EqK, A>, bool> google::dense_hashtable<Value, Key, HashFcn, ExtractKey, SetKey, EqualKey, Alloc>::insert_noresize(google::dense_hashtable<Value, Key, HashFcn, ExtractKey, SetKey, EqualKey, Alloc>::const_reference) [with Value = int; Key = int; HashFcn = std::tr1::hash; ExtractKey = google::dense_hash_set<int, std::tr1::hash, eqint>::Identity; SetKey = google::dense_hash_set<int, std::tr1::hash, eqint>::SetKey; EqualKey = eqint; Alloc = google::libc_allocator_with_realloc; google::dense_hashtable<Value, Key, HashFcn, ExtractKey, SetKey, EqualKey, Alloc>::const_reference = const int&]: Assertion `(!settings.use_empty() || !equals(get_key(obj), get_key(val_info.emptyval))) && "Inserting the empty key"' failed.

---

Any help would be greatly appreciated. Ie., where can I set max_path_from_root and what is the reason for the error with sample-set "all-files"? I realise that I can skip particular regions, however, I am not sure I know what reason causes the error in "all_samples"

All this is running on an Ubuntu box with 40 cores and 188 GB RAM. I am happy to provide additional information if needed.

thanks a lot for your time
Norman

[kdm9]

Hi all,

Also having this issue. It seems as though this has more to do with the sparsehash assertion error about "Inserting an empty key" more than the transient error/warning about too many paths from root.

Unfortunately that's where my debugging abilities end on this one, I'm simply too unfamiliar with the codebase to dig further. @mozack (or is it @lmose), if you have any pointers I (and @warthmann too I'm sure) would appreciate any guidance.

Best,
Kevin

[mozack]

Hi, if anyone can provide a smallish BAM file that can be used to reproduce the problem, I will take a look.

[warthmann]

Dear Lisle Mose, thank you for your consideration to look into our issue. Problem is: with smaller files, subsets of the “all_samples” file, the error doesn’t occur. we have provided for download the respective files you’d need to replicate the error, and the log file that documents our error. I am hoping you’ll be able to fix the issue. here the files for download: https://nextcloud.dsmz.de/s/bEfkA3nJ5jWRnR8 <https://nextcloud.dsmz.de/s/bEfkA3nJ5jWRnR8> Note that abra2 is part of a snakemake workflow that we’ve put together are/were about to roll out to plant breeding researchers in developing countries to help them embrace genomics. https://github.com/pbgl/dna-proto-workflow <https://github.com/pbgl/dna-proto-workflow> if the error persists we will have to remove abra2, which would be annoying. As said, we hope you can help best Norman

…

--- Norman WARTHMANN | Molecular Geneticist | Plant Breeding and Genetics Laboratory | Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture | Department of Nuclear Sciences and Applications | International Atomic Energy Agency | IAEA Laboratories, 2444 Seibersdorf, Austria | Email: ***@***.*** | T: (+43 1) 2600-28260 | Follow us on www.iaea.org

On 28 Sep 2021, at 23:26 , Lisle Mose ***@***.***> wrote: Hi, if anyone can provide a smallish BAM file that can be used to reproduce the problem, I will take a look. — You are receiving this because you were mentioned. Reply to this email directly, view it on GitHub <#45 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/ACG5CSEQJWAVWUN6R5VDQK3UEIXIBANCNFSM5CUTUP3A>. Triage notifications on the go with GitHub Mobile for iOS <https://apps.apple.com/app/apple-store/id1477376905?ct=notification-email&mt=8&pt=524675> or Android <https://play.google.com/store/apps/details?id=com.github.android&referrer=utm_campaign%3Dnotification-email%26utm_medium%3Demail%26utm_source%3Dgithub>.